Dataset for CDS Unclassified of organism Oppiella nova

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A7R9LYW1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Oppiella nova (length=903 residues).
atgccttttaaacgtgtttgcaatgtatgggtgcctgtgaagggtcggtggcgtggctgtagtgctgtagtgctggccat
tgagtggcgtatccctgagtctaaggaatgcttcgctgagagatcggcacaaaaggaagcgatcgctgcaatcgctgcca
aacctatgcatacgttcagcgaatactgcaatatatggcaatttgtggcaacaataacgtcgtccacaacgacgaccacc
tcatggagagtgcattggtacatcccaattgagtgcactattgatataatggccaccaatggctcatccaatgtgtctga
agtgcgaacaaatggtcaccgaatggagagttcgcttcagtcgatagtcaatgagttcttgtgttcacaattggctctca
aaggatacaattggactccagaggaagtggtgccaaacggtgtcaacagtgactctcataggactaaaatagtggacgcg
ttgaagacattgggccacaaatacgtgaacttatatgaggaacagttggctgcgatgtgtgagcgcctggagttgagtcc
ctcgacggcgatgacaacattcaacagtgtgtccaacgagttgttcatcgaaggcatcaaatggcatcatatcatcactt
tcctggtcttcggcgccgaattcgcgttcaattgcgttcaaaacggtttcccaaatctagtgaatgaagtctcgcattgg
atcaccacttatgtcacacaacacctcaacccatggatccgtgataatgggggctgggagtctgtgatcgagttatccga
cgacaaagtggttgcgggacagaagaaactgctttacggagcggccggtgctctcggagtgctaactctgggactgtttc
tgcgaaacttttctttcaaatga
>gnl|bcl2dbcds|A0A7R9QND1_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Oppiella nova (length=639 residues).
atggccaccaatggctcatccaatgtgtctgaagtgcgaacaaatggtcaccgaatggagagttcgcttcagtcgatagt
caatgagttcttgagttcacaattggctctcaaaggatacaattggactccagaggaagtggtgccaaacggtgtcaaca
gtgactctcataaccaatcattcaatttgagtgaaaggactaaaatagtggacgcgttgaagacattgggccacaaatac
gtgaacttatatgaggaacagttggctgcgatgtgtgagcgcctggagttgagtccgtcgacggcgatgacaacattcaa
cagtgtgtccaacgaattgttcatcgaaggcatcaaatggcatcatatcatcactttcctggtcttcagcgccgaattcg
cgttcaattgcgttcaaaacggtttcccaaatctagtgaatgaagtctcgcattggatcaccacttatgtcacacaacac
cttcacccatggatccgtgataatgggggctgggagtctgtgatcgagttatccgacgataaagtggttgcgggacagaa
gaaactgctttacggagcggccggtgctctcggagtgctaactctgggactgtttctgagaaacttttctttcaaatga
© 1998-2022Legal notice