Dataset for CDS BCL-2 of organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803VR88_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A803VR88_BCL2-02      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
                        **************************************************

A0A803VR88_BCL2-01      gtacatccactataaactctcgcagaggggatacgactgggctgccggcg
A0A803VR88_BCL2-02      gtacatccactataaactctcgcagaggggatacgactgggctgccggcg
                        **************************************************

A0A803VR88_BCL2-01      agcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcg
A0A803VR88_BCL2-02      agcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcg
                        **************************************************

A0A803VR88_BCL2-01      gttgctgctgctgctgggacttcctctgatcacactgggccggtgtctcc
A0A803VR88_BCL2-02      gttgctgctgctgctgggacttcctctgatcacactgggccggtgtctcc
                        **************************************************

A0A803VR88_BCL2-01      gcaccccgagccccccggctcggctgctgctagccccgcgcccccggccg
A0A803VR88_BCL2-02      gcaccccgagccccccggctcggctgctgctagccccgcgcccccggccg
                        **************************************************

A0A803VR88_BCL2-01      aggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcg
A0A803VR88_BCL2-02      aggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcg
                        **************************************************

A0A803VR88_BCL2-01      ggcgacgagttctcccggcgctaccagagggactttgcccaaatgtctgg
A0A803VR88_BCL2-02      ggcgacgagttctcccggcgctaccagagggactttgcccaaatgtctgg
                        **************************************************

A0A803VR88_BCL2-01      ccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
A0A803VR88_BCL2-02      ccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
                        **************************************************

A0A803VR88_BCL2-01      tggaggagctcttccgagacggggttaactggggcagaatcgtggccttc
A0A803VR88_BCL2-02      tggaggagctcttccgagacggggttaactggggcagaatcgtggccttc
                        **************************************************

A0A803VR88_BCL2-01      ttcgagtttggcggcgtgatgtgcgtggagagcgtcaacagggagatgtc
A0A803VR88_BCL2-02      ttcgagtttggcggcgtgatgtgcgtggagagcgtcaacagggagatgtc
                        **************************************************

A0A803VR88_BCL2-01      tccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggc
A0A803VR88_BCL2-02      tccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggc
                        **************************************************

A0A803VR88_BCL2-01      acctgcacaactggatccaggacaacggaggctgggatgcctttgtggag
A0A803VR88_BCL2-02      acctgcacaactggatccaggacaacggaggctgggaca-------gaag
                        *************************************         * **

A0A803VR88_BCL2-01      ttgtatggcaacagtatgaggcctttgttcgatttctcctggatctctct
A0A803VR88_BCL2-02      ctgcttcgcca------aatactttt------ttgtagctgcacagctat
                         **  * ** *       *  * ***      **    *** *   ** *

A0A803VR88_BCL2-01      gaagactatcctgagtctggttctggtgggagcttgcatca---ctcttg
A0A803VR88_BCL2-02      ggataccagctt--------------tggataccaacacaagggctattc
                        * * ** * * *              ***   *   **  *   ** ** 

A0A803VR88_BCL2-01      gcgcttatctcggacataagtag
A0A803VR88_BCL2-02      atgcttctccactggaaaaatga
                          **** **      * ** *  

© 1998-2022Legal notice