Dataset for CDS Unclassified of Organism Electrophorus electricus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A4W4FPJ0_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Electrophorus electricus (length=600 residues).
atgaggaagtctgaccagtccacgactagccagggtctgaccaaccccgaccccctggtgcgggaggcctacctgatggc
ttatgactacattgactacatgacggcccggccgggggtatcgtcacgccctgcaccctctctggccgcggcagccctgc
gtcacgccggggacgagctcctccatcgcttccctatcttcttccggcgctggccacgtgtcttccacgatgtgacggag
gagacggcgtgtgacaccctggtgtccatcctggacgagcacttcgccccgacacgccgccgcgacctagcctggagcgc
cgtgctctccacctacgtgctggccggccagatggcgctgcactgtcaggggaggggcatgaccagtgttctgcctcagc
tccagcactgcgtgggcagctacgtggagagggtcatctgtcccgaaatcaaggacagaggaggatggtcaggttttgtg
tctcgttttgggaagaagcagaacttggagggccaagtgaaaaaggcatgctgttggagtctggtaatactgactgctgg
gatccttgcctacttcgtatggaaaaaaagaataacataa
>gnl|bcl2dbcds|A0A4W4GCH1_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Electrophorus electricus (length=621 residues).
atgtcgtgtgaaggaacaacggatgaccaaattggagaggcagtcttgatcggagtaataaaggaccaggtaaggcacat
aacttgtgaaggaaacatccccccactgcgccttcctgacatgaaaccaataaccaacgagaatgatcagatgctagtag
atcaaatcgcagaaacgatcagagttattggtgatcggctcgatcaagatccaagatttaatgatatgatggatggattg
ggacgtgtggctgataaaagctgtttctggaagctggtggagaatgtcttcagcaatggacagattaactggggaagaat
tattgtgctgttctactcagtaggaaaactgtctgcaaagatggtcctagcgcgattgcctgcagtggtctcagacatac
tttctttgtgtctggacttcttcaggagaaagcttttggactggatctgcaacatgggaggatggattaacagcatttcc
gaactggcccgtttcgccattgaacaagtttctacttcctccatcagaaccatctcgccttctgtagcactgggcctggt
tttcatcagtggggtacttctgggagcgctcatcagttggagaatgaacagaatcagctga
>gnl|bcl2dbcds|A0A4W4H075_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Electrophorus electricus (length=528 residues).
atgaggtatcagacaccacctgagggagcagtggcacgaaggaaaacaaagaacatggataaaggaggcacctctgaggc
agaagacactgaagaatgggaaacacaaagctgttgcacaatcttattaagaacctatgtactggtgcaaattgctagag
aacacccaaacatactgcttaatgctgaggtcttgggggggtatctcaatgaaggagatggtttccttgtgaattgtgct
gttaccttgctcactgaaatttctaattttgaccacaactggggacatgtgactgcttttcactactttgcataccttct
cattctcaacgaggtgactgggtgtcattttgaaagagcaaagatggtcatgttttgggcttcacagattatgagagata
aaatgcttctaaggcgatggataaaactggccattgatttattactgagtaaaactaaataccttgctttctttgctgct
ggtgttaccgtggcgaggtttttcctgtactggacaaaaactcactaa
© 1998-2023Legal notice