Dataset for CDS BAX of Organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2E537_BAX-01      ------atggcagaaggaggtggaggtgac------------caagggaa
A0A3Q2CP03_BAX-02      ------atgctagcatcacat-------------actagccaagaaaggg
A0A3Q2CP03_BAX-01      ---------------------------------------------atgtg
A0A3Q2CP03_BAX-03      tctttcatacaaacattacagtgttgtggtgctagttacctacaaatgtg

A0A3Q2E537_BAX-01      tccggttgatcctatggtggaagttggagctgtgttgctaaagga-----
A0A3Q2CP03_BAX-02      tct--ctagcatttt--------------atgcttaaacaataca---tc
A0A3Q2CP03_BAX-01      tcttatctgtactct--------------ctactctctccaaatgttttc
A0A3Q2CP03_BAX-03      tcttatctgtactct--------------ctactctctccaaatgttttc
                       **          * *               *         *         

A0A3Q2E537_BAX-01      ---tttcatctaccagcggattcggcggcacgt--------agacggcga
A0A3Q2CP03_BAX-02      tattttcgtcgtgaagtggattcagcgacatgcattaagtaaggtgccga
A0A3Q2CP03_BAX-01      tagtttcgtcgtgaagtggattcagcgacatgcattaagtaaggtgccga
A0A3Q2CP03_BAX-03      tagtttcgtcgtgaagtggattcagcgacatgcattaagtaaggtgccga
                          **** **    ** ****** *** ** *         **  * ***

A0A3Q2E537_BAX-01      tactgatgtgacccgggaacagttgggtgccacggagctatgtgacccaa
A0A3Q2CP03_BAX-02      tcct--------ccaggaagcgttgggtgtaacagctctctgtgacccac
A0A3Q2CP03_BAX-01      tcct--------ccaggaagcgttgggtgtaacagctctctgtgacccac
A0A3Q2CP03_BAX-03      tcct--------ccaggaagcgttgggtgtaacagctctctgtgacccac
                       * **        ** ****  ********  ** *  ** ********* 

A0A3Q2E537_BAX-01      accatttaaagctcgctcagtgtctccagcagattggagatgagctggat
A0A3Q2CP03_BAX-02      agcagcagaaagtctctgatgcctttcaggttgttgcggatgaa------
A0A3Q2CP03_BAX-01      agcagcagaaagtctctgatgcctttcaggttgttgcggatgaa------
A0A3Q2CP03_BAX-03      agcagcagaaagtctctgatgcctttcaggttgttgcggatgaagtggat
                       * **    **  ** ** *     * ***    ***  *****       

A0A3Q2E537_BAX-01      ggaaacatggagctgcagaggatgatagaggactctgccctcaaaccaac
A0A3Q2CP03_BAX-02      ------------------------------gttccatcattcactccctc
A0A3Q2CP03_BAX-01      ------------------------------gttccatcattcactccctc
A0A3Q2CP03_BAX-03      ggagaaggagggattaaaaagctaatagaggttccatcattcactccctc
                                                     *   *  *  ***  **  *

A0A3Q2E537_BAX-01      aaaagatgtcttcatgaaagtggcacttcagatcttttctgatggtagat
A0A3Q2CP03_BAX-02      aaaggaagtgtttgtgaaaattgtccgcgaactcttttccgatggggaga
A0A3Q2CP03_BAX-01      aaaggaagtgtttgtgaaaattgtccgcgaactcttttccgatggggaga
A0A3Q2CP03_BAX-03      aaaggaagtgtttgtgaaaattgtccgcgaactcttttccgatggggaga
                       *** ** ** **  ***** * *  *   *  ******* *****     

A0A3Q2E537_BAX-01      tcaactggggtcgagtggttgcgctgttctactttgcctgtcgactcgtc
A0A3Q2CP03_BAX-02      tcaactggggcagggtggttaccgtcttctgctttgccggcatgtttgtc
A0A3Q2CP03_BAX-01      tcaactggggcagggtggttaccgtcttctgctttgccggcatgtttgtc
A0A3Q2CP03_BAX-03      tcaactggggcagggtggttaccgtcttctgctttgccggcatgtttgtc
                       **********  * ****** *  * **** ******* *     * ***

A0A3Q2E537_BAX-01      ataaaagcccttatcaccaaaattccagaaatcatcagaactataatcaa
A0A3Q2CP03_BAX-02      ttgaaagctcatgaaagcaaaatatgtgagttaatcaaaaccataatcag
A0A3Q2CP03_BAX-01      ttgaaagctcatgaaagcaaaatatgtgagttaatcaaaaccataatcag
A0A3Q2CP03_BAX-03      ttgaaagctcatgaaagcaaaatatgtgagttaatcaaaaccataatcag
                        * ***** * *   * ******    **  * **** *** ******* 

A0A3Q2E537_BAX-01      ctggaccatagactacatccgggatcatgtgatcaactggatcagagagc
A0A3Q2CP03_BAX-02      ctggatcatagactttttccgagaaaaggtgcttggctggataaaggagc
A0A3Q2CP03_BAX-01      ctggatcatagactttttccgagaaaaggtgcttggctggataaaggagc
A0A3Q2CP03_BAX-03      ctggatcatagactttttccgagaaaaggtgcttggctggataaaggagc
                       ***** ********   **** **  * *** *   ****** *  ****

A0A3Q2E537_BAX-01      aaggtggctgggagggtattcgctcctacttcggcacgcctacatggcag
A0A3Q2CP03_BAX-02      aaggcggctgggagggaattttttcctacgtcggcattcccatgtggcaa
A0A3Q2CP03_BAX-01      aaggcggctgggagggaattttttcctacgtcggcattcccatgtggcaa
A0A3Q2CP03_BAX-03      aaggcggctgggagggaattttttcctacgtcggcattcccatgtggcaa
                       **** *********** ***   ****** ******  ** *  ***** 

A0A3Q2E537_BAX-01      acggtgggtgtcttcctggctggagttcttgccactgtttttgtcatgcg
A0A3Q2CP03_BAX-02      tttttggggatttttctggctggggttgtcaccacccttgtcgtcgtcca
A0A3Q2CP03_BAX-01      tttttggggatttttctggctggggttgtcaccacccttcaaacca---a
A0A3Q2CP03_BAX-03      tttttggggatttttctggctggggttgtcaccacccttgtcgtcgtcca
                           ****  * ** ******** *** *  ****  **     *     

A0A3Q2E537_BAX-01      caagatg------------------tga
A0A3Q2CP03_BAX-02      caagatgaggg---------ccgaatga
A0A3Q2CP03_BAX-01      gaagttaatgggaggatttacagagtaa
A0A3Q2CP03_BAX-03      caagatgaggg---------ccgaatga
                        *** *                   * *

© 1998-2023Legal notice