Dataset for CDS BCL-2-like of organism Monodon monoceros

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A4V5P8C2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodon monoceros GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaacagcccgggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaagcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A4V5P8C2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodon monoceros GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgcca
gccggaaagcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
>gnl|bcl2dbcds|A0A8C6AXM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodon monoceros GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgcgggcgccacgtccccgggggccgcccccgcgccgggcatcttctcctcccagcctg
ggagcaccccagcgccatccaggacctccccgccgccgccccagaccgctcccgccgcccccgccagggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggagtaaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtacggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C6BK57_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Monodon monoceros GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcggatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaaggggggcccaactggggccgccttgtggctttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagcgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C6F2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodon monoceros GN=BCL2L1 (length=702 residues).
atgtctcagagcaatcgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6FDW6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Monodon monoceros GN=BCL2A1 (length=528 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgccttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggaaaatggctttgtaaagaagtttgaacccaagtctggctggctgacttttctggaagtt
acaggaaagatctgtgaaatattatgtctcctgaagcagtactattga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice