Dataset for CDS BCL-2-like of organism Monodon monoceros

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4V5P8C2_MCL1-01      atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgg
A0A4V5P8C2_MCL1-02      atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgg

A0A4V5P8C2_MCL1-01      gggggccggattgggaccggatagcggcagcggcgcctccgctccgggaa
A0A4V5P8C2_MCL1-02      gggggccggattgggaccggatagcggcagcggcgcctccgctccgggaa

A0A4V5P8C2_MCL1-01      ggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtaggg
A0A4V5P8C2_MCL1-02      ggcggctttt----------------------------------------

A0A4V5P8C2_MCL1-01      ggaggggaagccggcgaggtgattggcggaagcgccggcccgagcccccc
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      ggccactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattg
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      gcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttc
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      gcgcccacccgccgcgcctcgccgcccgaagagatggaatcctcggtctc
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      cgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgag
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      gccagtaacagcccgggcaaggacggctcactcccctcgacgccgccccc
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
A0A4V5P8C2_MCL1-02      --------------------------------------------------

A0A4V5P8C2_MCL1-01      ctcgatacctccgggagcaggcaaccggcaccaaggacgcgaagccactg
A0A4V5P8C2_MCL1-02      -------------------ggcaaccggcaccaaggacgcgaagccactg

A0A4V5P8C2_MCL1-01      ggcgggtctggggccgccagccggaaagcgttagagaccctgcgacgggt
A0A4V5P8C2_MCL1-02      ggcgggtctggggccgccagccggaaagcgttagagaccctgcgacgggt

A0A4V5P8C2_MCL1-01      cggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttc
A0A4V5P8C2_MCL1-02      cggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttc

A0A4V5P8C2_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A4V5P8C2_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg

A0A4V5P8C2_MCL1-01      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A4V5P8C2_MCL1-02      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac

A0A4V5P8C2_MCL1-01      tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaacc
A0A4V5P8C2_MCL1-02      tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaacc

A0A4V5P8C2_MCL1-01      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
A0A4V5P8C2_MCL1-02      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta

A0A4V5P8C2_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A4V5P8C2_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt

A0A4V5P8C2_MCL1-01      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A4V5P8C2_MCL1-02      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc

A0A4V5P8C2_MCL1-01      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata
A0A4V5P8C2_MCL1-02      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata

A0A4V5P8C2_MCL1-01      agatag
A0A4V5P8C2_MCL1-02      agatag

© 1998-2021Legal notice