Dataset for CDS BCL2A1 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      atgtttcgccaggctccacaagcttgtgcttcagactgtcttggtcactt
                                                                          

A0A452EK63_BCL2A1-      -------------------------------------------atgactg
A0A8C2RKE2_BCL2A1-      gcaggtgagcaggctcaagacgctactccccagcaaggagaagatgactg
                                                                   *******

A0A452EK63_BCL2A1-      acactgagtttgactacgttcacaagctggctgaggactatctgaaatat
A0A8C2RKE2_BCL2A1-      acactgagtttgactacgttcacaagctggctgaggactatctgaaatat
                        **************************************************

A0A452EK63_BCL2A1-      gtgttgcagatacagcaacctggatccaagccaagcaaaacatccagggt
A0A8C2RKE2_BCL2A1-      gtgttgcagatacagcaacctggatccaagccaagcaaaacatccagggt
                        **************************************************

A0A452EK63_BCL2A1-      gttacaagacgtggcttcctctgtccaggacgaagtggaaaggactttga
A0A8C2RKE2_BCL2A1-      gttacaagacgtggcttcctctgtccaggacgaagtggaaaggactttga
                        **************************************************

A0A452EK63_BCL2A1-      agcagtgcttggataagtttgatgtggtgtctgtagacactgccagaaca
A0A8C2RKE2_BCL2A1-      agcagtgcttggataagtttgatgtggtgtctgtagacactgccagaaca
                        **************************************************

A0A452EK63_BCL2A1-      atattcaaccaagtgatggaaaaggaatttgaagatggcattgttaactg
A0A8C2RKE2_BCL2A1-      atattcaaccaagtgatggaaaaggaatttgaagatggcattgttaactg
                        **************************************************

A0A452EK63_BCL2A1-      gggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaac
A0A8C2RKE2_BCL2A1-      gggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaac
                        **************************************************

A0A452EK63_BCL2A1-      ttctgagcaagcgtattgcctcagacatggacatgtgcaaggacatttct
A0A8C2RKE2_BCL2A1-      ttctgagcaagcgtattgcctcagacatggacatgtgcaaggacatttct
                        **************************************************

A0A452EK63_BCL2A1-      tatttcgtggcggagtttatcaccgaaaacacaggagagtggataaggca
A0A8C2RKE2_BCL2A1-      tatttcgtggcggagtttatcaccgaaaacacaggagagtggataaggca
                        **************************************************

A0A452EK63_BCL2A1-      aaacggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctg
A0A8C2RKE2_BCL2A1-      aaacggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctg
                        **************************************************

A0A452EK63_BCL2A1-      gctggctgacttttctggaagttacaggaaagatctgtgaaacattatgt
A0A8C2RKE2_BCL2A1-      gctggctgacttttctggaagttacaggaaagatctgtgaaacattatgt
                        **************************************************

A0A452EK63_BCL2A1-      cgtctgaagcaatactattga
A0A8C2RKE2_BCL2A1-      cgtctgaagcaatactattga
                        *********************

© 1998-2022Legal notice