Dataset for CDS BAX-like of Organism Gadus morhua

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C4Z5R5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=897 residues).
atggaacgtcaagggacacctagagacgacataatcgaagttggaaaaattctgttaacggatttcatttatcagagggt
gcttcgaaatggcgatggaccggctgtatcaagagccgaactgggtggtaaagaattgactaaccagaaccataaaaacc
ttgcacagtgcctacagcagatcggagatgacctggatggcaacactcagctacaaaacatgatcaacagttcggcgctt
gttccctcgaaggatgttttcctgagtgtggcccgtgagatattctctgatggggtattcaattggggcagagttgtggc
tctcttctacttcgcctgtcgcatggtcataaaagcactgatgaccagagtccctgatattatcaggactataatctctt
ggaccatggactacctgtctgaaaacgtgatgaactggatcagagagcaaggaggctgggtaagttgtctgtgttcaaac
tcaaaccccaaaataagtttcatcaatcatcgggatactaaatctcttatcactattataggaaggaattcgatcctatt
ttggaaccccttcatggcaaacctttggggtcttcgtggccggagtcctggccgctgcaatcgtcatgcgcaagctgtga
gcagttgtaggggagagatgcagagagagcggagaagactgaaacacctgcaatgggtcggatcggttgtaagggacgag
aaaagtgagaaggctgccaatggaaaccgtaaacatcagcaaatatcagttttgcacaagattcgttctatgttcttctt
ttcattggcctcaatttgtgtggcaacggttaggagttccattgcgattgggtgtagctgtcttccctgcatttccgagt
tttcaggcaattcttga
>gnl|bcl2dbcds|A0A8C4Z5R5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=558 residues).
atggaacgtcaagggacacctagagacgacataatcgaagttggaaaaattctgttaacggatttcatttatcagagggt
gcttcgaaatggcgatggaccggctgtatcaagagccgaactgggtggtaaagaattgactaaccagaaccataaaaacc
ttgcacagtgcctacagcagatcggagatgacctggatggcaacactcagctacaaaacatgatcaacagttcggcgctt
gttccctcgaaggatgttttcctgagtgtggcccgtgagatattctctgatggggtattcaattggggcagagttgtggc
tctcttctacttcgcctgtcgcatggtcataaaagcactgatgaccagagtccctgatattatcaggactataatctctt
ggaccatggactacctgtctgaaaacgtgatgaactggatcagagagcaaggaggctgggaaggaattcgatcctatttt
ggaaccccttcatggcaaacctttggggtcttcgtggccggagtcctggccgctgcaatcgtcatgcgcaagctgtga
>gnl|bcl2dbcds|A0A8C4Z5R5_BAX-03 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=915 residues).
atggcatcgccgaacggaggtggtgattcagggacacctagagacgacataatcgaagttggaaaaattctgttaacgga
tttcatttatcagagggtgcttcgaaatggcgatggaccggctgtatcaagagccgaactgggtggtaaagaattgacta
accagaaccataaaaaccttgcacagtgcctacagcagatcggagatgacctggatggcaacactcagctacaaaacatg
atcaacagttcggcgcttgttccctcgaaggatgttttcctgagtgtggcccgtgagatattctctgatggggtattcaa
ttggggcagagttgtggctctcttctacttcgcctgtcgcatggtcataaaagcactgatgaccagagtccctgatatta
tcaggactataatctcttggaccatggactacctgtctgaaaacgtgatgaactggatcagagagcaaggaggctgggta
agttgtctgtgttcaaactcaaaccccaaaataagtttcatcaatcatcgggatactaaatctcttatcactattatagg
aaggaattcgatcctattttggaaccccttcatggcaaacctttggggtcttcgtggccggagtcctggccgctgcaatc
gtcatgcgcaagctgtgagcagttgtaggggagagatgcagagagagcggagaagactgaaacacctgcaatgggtcgga
tcggttgtaagggacgagaaaagtgagaaggctgccaatggaaaccgtaaacatcagcaaatatcagttttgcacaagat
tcgttctatgttcttcttttcattggcctcaatttgtgtggcaacggttaggagttccattgcgattgggtgtagctgtc
ttccctgcatttccgagttttcaggcaattcttga
>gnl|bcl2dbcds|A0A8C4Z5R5_BAX-04 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=888 residues).
atggggacacctagagacgacataatcgaagttggaaaaattctgttaacggatttcatttatcagagggtgcttcgaaa
tggcgatggaccggctgtatcaagagccgaactgggtggtaaagaattgactaaccagaaccataaaaaccttgcacagt
gcctacagcagatcggagatgacctggatggcaacactcagctacaaaacatgatcaacagttcggcgcttgttccctcg
aaggatgttttcctgagtgtggcccgtgagatattctctgatggggtattcaattggggcagagttgtggctctcttcta
cttcgcctgtcgcatggtcataaaagcactgatgaccagagtccctgatattatcaggactataatctcttggaccatgg
actacctgtctgaaaacgtgatgaactggatcagagagcaaggaggctgggtaagttgtctgtgttcaaactcaaacccc
aaaataagtttcatcaatcatcgggatactaaatctcttatcactattataggaaggaattcgatcctattttggaaccc
cttcatggcaaacctttggggtcttcgtggccggagtcctggccgctgcaatcgtcatgcgcaagctgtgagcagttgta
ggggagagatgcagagagagcggagaagactgaaacacctgcaatgggtcggatcggttgtaagggacgagaaaagtgag
aaggctgccaatggaaaccgtaaacatcagcaaatatcagttttgcacaagattcgttctatgttcttcttttcattggc
ctcaatttgtgtggcaacggttaggagttccattgcgattgggtgtagctgtcttccctgcatttccgagttttcaggca
attcttga
>gnl|bcl2dbcds|A0A8C4ZA97_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gadus morhua GN=BOK (length=672 residues).
atggagatgctccgtcgctcctcagtgttcgcggccgaagtgatggacgtgtttgaccgctcgcccaccgataaggagct
ggtgtcccaggcgaaggcgctgtgtagggactacatccactccagactcaaccgggccggtatcggctggaccaagccgg
accacgggctgtctgcgtcgggcggcagcgcgctgggggacacctcgtcggtcatcctgtggctaggtgatgagctggaa
tacctgcgcccgaacatctaccgtaacgtggcgaagcagctgaacatcaccgtggcgtccgagagcatcgtgtccgacgc
cttcctagccgtcgccgccgagatcttctccacaggacccttagctaaacacaccattacctgtgtgacgtgggggaagg
tggtctccctgtacgcggtggcgggggctctggcggtggactgcgttcgtcatggccaccccgccatggtccacaccatc
gtggactgcatgggggagttcgtccgtaagagcctgatcccctggctgaagaggcgcgggggatgggtggacgtcaccaa
gtgtgtgatcaacaccgaccccagcttcagagcccattggctggtgtcggccgccagcacctgtggccagtacctgaagg
cggtggtgttctacctgctgagggagaagtga
>gnl|bcl2dbcds|A0A8C4ZA97_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gadus morhua GN=BOK (length=645 residues).
atggagatgctccgtcgctcctcagtgttcgcggccgaagtgatggacgtgtttgaccgctcgcccaccgataaggagct
ggtgtcccaggcgaaggcgctgtgtagggactacatccactccagactcaaccgggccggtatcggctggaccaagccgg
accacgggctgtctgcgtcgggcggcagcgcgctgggggacacctcgtcggtcatcctgtggctaggtgatgagctggaa
tacctgcgcccgaacatctaccgtaacgtggcgaagcagctgaacatcaccgtggcgtccgagagcatcgtgtccgacgc
cttcctagccgtcgccgccgagatcttctccacaggtgtgacgtgggggaaggtggtctccctgtacgcggtggcggggg
ctctggcggtggactgcgttcgtcatggccaccccgccatggtccacaccatcgtggactgcatgggggagttcgtccgt
aagagcctgatcccctggctgaagaggcgcgggggatgggtggacgtcaccaagtgtgtgatcaacaccgaccccagctt
cagagcccattggctggtgtcggccgccagcacctgtggccagtacctgaaggcggtggtgttctacctgctgagggaga
agtga
>gnl|bcl2dbcds|A0A8C4ZB81_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gadus morhua GN=BOK (length=642 residues).
atggaagtgcttcggaagtcctcagaattcgctgcggaggtgctggacgtgtttgaccgctcggtgagcgacaaggagct
ggtgttccaggccaaggcgctgtaccgagactacgtcctctgcaggctcaaccaacacgggtttgggtgggccaggagcg
agctccacttcccctccaccagtgcagcgctggccgaggtgtctctggtgctcctgtatctcggcgatgagttggagtgt
atgcacccaagtctctacaggaacgtggctcggcaactcaacatttctgttgccatggagaatatggtatcggatgcctt
cattgctgtggcaacagagatcttttcaacaggtataacatggggcaaggtggtgtccatgttcgcagtggcggcgggtc
tggctgtggattgtgtgcggcagggccggccagccaccgtgcacgtccttgtggacagccttggccagctggtccgcagg
tacctggtgccctggctcaagagaaagggaggctggacggaaattagcaaatgtgtcataaagaaggacgtcatctctga
acaccactggctgtcctccactgtggagtccttgaagtactttctcactacagtttacgtatacgtcatgaaggaacaat
ga
>gnl|bcl2dbcds|A0A8C4ZIU9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=606 residues).
atggcagacgccgacggccgggatcgcgcggaggaacagggcgccgcggggggcgaagatgtcatcgatgaccccatcat
ggagcagggggctttgattctgagagggtacgtgatgcactgcatcagcgcctatgacccggccatgcaggtctcctctg
aggacctgggtggggcccccaatgagcagctggaccctcagatgaaggagttggtggagatgatgcgggaaaaatccgac
gtcctggaccagaacgctgagcttgagaacctgatcagccaggtccaggggaactgtgtccagggcgtcttcatgaaggt
ggctaagagcatcttcaatgacggcatcacctggggccgtgtggcgtccctcttctacctcgcctacaaattcatctaca
aggcgctgaccatgaaccacatggagaacatccggatcatcatcagctgggtgctgcagttcatcagggagcagctgcac
acctggatcgctcagcaggggggctgggagggcgtggtcaggggtatctcccgctggcggacggtgacggcgctggcctc
cgtggtgctggtggtggccttcgtctactacaggaagtcgcgctag
>gnl|bcl2dbcds|A0A8C4ZIU9_BAX-02 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=606 residues).
atggcagacgccgacggccgggatcgcgcggaggaacagggcgccgcggggggcgaagatgtcatcgatgaccccatcat
ggagcagggggctttggttctgagagggtacgtgatgcaccgtatcggcgacattgacccggccatgcaggtctcctctg
aggacctgggtggggcccgcaacgagcagcaagaccctcagatcaaggcggtggtggagcagctgctgcagatcgccgac
gacctgaaccagaacgccgagctccagagcctgatcagccaggtccaggggaactgtgtccaggacgtcttcatgaaggt
ggctaagagcatcttcaatgacggcatcacctggggacgtgtggtggccctcttccacctggcctacaaactcatctaca
aggcgctgaccatgaaccacatggagaacatccggatcatcatcagctgggtgctgcagttcatcagggagcagctgcac
acctggatcgctcagcaggggggctgggagggcgtggtcaggggtatctcccgctggcggacggtgacggcgctggcctc
cgtggtgctggtggtggccttcgtctactacaggaagtcgcgctag
>gnl|bcl2dbcds|A0A8C4ZIU9_BAX-03 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=606 residues).
atggcagacgccgacggccgggatcgcgcggaggaacagggcgccgcggggggcgaagatgtcatcgatgaccccatcat
ggagcagggggctttggttctgagagggtacgtgatgcaccgtatcggcgacattgacccggccatgcaggtctcctctg
aggacctgggtggggcccgcaacgagcagcaagaccctcagatcaaggcggtggtggagcagctgctgcagatcgccgac
gacctgaaccagaacgccgagctccagagcctgatcagccaggtccaggggaactgtgtccaggacgtcttcatgaaggt
ggctaagagcatcttcaatgacggcatcacctggggacgtgtggtggccctcttccacctggcctacaaactcatctaca
aggcgctgaccatgaaccacatggagaacatccggatcatcatcagctgggtgctgcagttcatcagggagcagctgcac
acctggatcgctcagcaggggggctgggagggcgtggtcaggggtatctcccgctggcggacggtgacggcgctggcctc
cgtggtgctggtggtggccttcgtctactacaggaagtcgcgctag
>gnl|bcl2dbcds|A0A8C4ZIU9_BAX-04 BCL2-associated X gene OS=[Eukaryota] Gadus morhua GN=BAX (length=615 residues).
atggcagacgccgacggccgggatcgcgcggaggaacagggcgccgcggggggcgaagatgtcatcgatgaccccatcat
ggagcagggggctttgattctgagagggtacgtgatgcactgcatcagcgcctatgacccggccatgcaggtctcctctg
aggacctgggtggggcccccaatgagcagctggaccctcagatgaaggagttggtggagatgatgcgggaaaaatccgac
gtcctggaccagaacgctgagcttgagaacctgatcagccaggtccaggggaactgtgtccagggcgtcttcatgaaggt
ggctaagagcatcttcaatgacggcatcacctggggccgtgtggcgtccctcttctacctcgcctacaaattcatctaca
aggcgctgaccatgaaccacatggagaacatccggatcatcatcagctgggtgctgcagttcatcagggagcagctgcac
ccctggatcgctcagcaggggggctgggggagaaaggagggcgtggtcaggggtatctcccgctggcggacggtgacggc
gctggcctccgtggtgctggtggtggccttcgtctactacaggaagtcgcgctaa
© 1998-2023Legal notice