Dataset for CDS MCL-1 of organism Panthera leo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C8Y0M9_MCL1-01      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
A0A8C8Y0M9_MCL1-02      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg

A0A8C8Y0M9_MCL1-01      gggggccgggctggcggccgggagcggcggcgcctcctcttcgggagggc
A0A8C8Y0M9_MCL1-02      gggggccgggctggcggccgggagcggcggcgcctcctcttcgggagggc

A0A8C8Y0M9_MCL1-01      ggcttgtggctgtggggaaggaggccacggcccggcgagaggtaggggga
A0A8C8Y0M9_MCL1-02      ggcttgt-------------------------------------------

A0A8C8Y0M9_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      ccgagggccccgacgtcaccgcgacccctccgaagctgctgttcttcgcg
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      cgccatcatgtcgcccgaagaggaactagacgggtacgagccagaacctc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------

A0A8C8Y0M9_MCL1-01      ggtaccttcgggagcaggcgactggcgccaaggacgcgaaaccactgggc
A0A8C8Y0M9_MCL1-02      ----------------ggcgactggcgccaaggacgcgaaaccactgggc

A0A8C8Y0M9_MCL1-01      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
A0A8C8Y0M9_MCL1-02      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg

A0A8C8Y0M9_MCL1-01      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
A0A8C8Y0M9_MCL1-02      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga

A0A8C8Y0M9_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8C8Y0M9_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg

A0A8C8Y0M9_MCL1-01      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A8C8Y0M9_MCL1-02      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct

A0A8C8Y0M9_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
A0A8C8Y0M9_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag

A0A8C8Y0M9_MCL1-01      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtgagg
A0A8C8Y0M9_MCL1-02      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtgagg

A0A8C8Y0M9_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A8C8Y0M9_MCL1-02      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga

A0A8C8Y0M9_MCL1-01      gttcttccacgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A8C8Y0M9_MCL1-02      gttcttccacgtagaggacctagaaggtggcatcagaaatgtgctgctgg

A0A8C8Y0M9_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A8C8Y0M9_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga

A0A8C8Y0M9_MCL1-01      tag
A0A8C8Y0M9_MCL1-02      tag

© 1998-2023Legal notice