Dataset for CDS BCL-2-like of organism Cebus imitator

[Download (right click)] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A2K5RIU7_BCL2L10-01      ---------------------------------atggctgacccgctg-c
A0A2K5R5C4_MCL1-01         ---------------------------------atgtttggcctccaaag
A0A2K5R5C4_MCL1-04         ---------------------------------atgtttggcctccaaag
A0A2K5R5C4_MCL1-02         ---------------------------------atgtttggcctccaaag
A0A2K5R5C4_MCL1-03         ---------------------------------atgtttggcctccaaag
A0A2K5PYQ3_BCL2A1-01       ---------------------------------atgacagacagtgaa--
A0A2K5PYQ3_BCL2A1-02       ---------------------------------atgacagacagtgaa--
A0A2K5RUN8_BCL2L2-03       ---------------------------------atggcgaccccagcctc
A0A2K5RUN8_BCL2L2-01       catctttcatccttgcctcttatagccgcccggatggcgaccccagcctc
A0A2K5RUN8_BCL2L2-05       ---------------------------------atggcggcggcggcggc
A0A2K5RUN8_BCL2L2-02       ---------------------------------atggcgaccccagcctc
A0A2K5RUN8_BCL2L2-04       ---------------------------------atggcggcggcggcggc
A0A2K5Q6R6_BCL2L1-03       ---------------------------------atg--------------
A0A2K5PP81_BCL2-01         ---------------------------------atggcgcaagctgggag
A0A2K5Q6R6_BCL2L1-01       ---------------------------------atgtctcag--------
A0A2K5Q6R6_BCL2L1-02       ---------------------------------atgtctcag--------
                                                            ***              

A0A2K5RIU7_BCL2L10-01      ----g---gcagcgcaccga---gcggctggtggcggactacctggagta
A0A2K5R5C4_MCL1-01         aaacgcggtaatcggactcaacctctactgtgg----gggggccggcttg
A0A2K5R5C4_MCL1-04         aaacgcggtaatcggactcaacctctactgtgg----gggggccggcttg
A0A2K5R5C4_MCL1-02         aaacgcggtaatcggactcaacctctactgtgg----gggggccggcttg
A0A2K5R5C4_MCL1-03         aaacgcggtaatcggactcaacctctactgtgg----gggggccggcttg
A0A2K5PYQ3_BCL2A1-01       -------------------tt-tggatatattca----------------
A0A2K5PYQ3_BCL2A1-02       -------------------tt-tggatatattca----------------
A0A2K5RUN8_BCL2L2-03       ----g---gccccagacacac-gggctctggtggcagactttgtaggtta
A0A2K5RUN8_BCL2L2-01       ----g---gccccagacacac-gggctctggtggcagactttgtaggtta
A0A2K5RUN8_BCL2L2-05       ----g---gcggcagcagcagcgggggctgcgg----gcggtcggggctc
A0A2K5RUN8_BCL2L2-02       ----g---gccccagacacac-gggctctggtggcagactttgtaggtta
A0A2K5RUN8_BCL2L2-04       ----g---gcggcagcagcagcgggggctgcgg----gcggtcggggctc
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         aac-a---gggtacgataacc-gggagatagtgatgaagtacatccacta
A0A2K5Q6R6_BCL2L1-01       --------------agcaacc-gggagctggtggttgactttctctccta
A0A2K5Q6R6_BCL2L1-02       --------------agcaacc-gggagctggtggttgactttctctccta
                                                                             

A0A2K5RIU7_BCL2L10-01      ctgctccc-gggagcc---cggcacccccg--agtc--------------
A0A2K5R5C4_MCL1-01         ggggctggcagcggcggcgccacccctccgggagggcggcttttggccac
A0A2K5R5C4_MCL1-04         ggggctggcagcggcggcgccacccctccgggagggcggcttttgg----
A0A2K5R5C4_MCL1-02         ggggctggcagcggcggcgccacccctccgggagggcggcttttggccac
A0A2K5R5C4_MCL1-03         ggggctggcagcggcggcgccacccctccgggagggcggcttttggccac
A0A2K5PYQ3_BCL2A1-01       caatctaa-ctcag-----gactat------ctgtg--------------
A0A2K5PYQ3_BCL2A1-02       caatctaa-ctcag-----gactat------ctgtg--------------
A0A2K5RUN8_BCL2L2-03       taagctga-ggcagaagggttatgt------ctgtg--------------
A0A2K5RUN8_BCL2L2-01       taagctga-ggcagaagggttatgt------ctgtg--------------
A0A2K5RUN8_BCL2L2-05       cgggccgg-ggcggcggcgccatct-------tgtg--------------
A0A2K5RUN8_BCL2L2-02       taagctga-ggcagaagggttatgt------ctgtg--------------
A0A2K5RUN8_BCL2L2-04       cgggccgg-ggcggcggcgccatct-------tgtg--------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         taagctgt-cgcagaggggctacga------gtggg--------------
A0A2K5Q6R6_BCL2L1-01       caagcttt-cccagaaaggatacag------ctgga--------------
A0A2K5Q6R6_BCL2L1-02       caagcttt-cccagaaaggatacag------ctgga--------------
                                                                             

A0A2K5RIU7_BCL2L10-01      ------------gcc---g-ccggccacggccgaggccgctgtgctgcgc
A0A2K5R5C4_MCL1-01         ggagaaggaggcctcggcccagcgaga-------ggtagggggaggggag
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         ggagaaggaggcctcggcccagcgaga-------ggtagggggaggggag
A0A2K5R5C4_MCL1-03         ggagaaggaggcctcggcccagcgaga-------ggtagggggaggggag
A0A2K5PYQ3_BCL2A1-01       ------------gta-----cg----tcctgcagataccacaatctggaa
A0A2K5PYQ3_BCL2A1-02       ------------gta-----cg----tcctgcagataccacaatctggaa
A0A2K5RUN8_BCL2L2-03       ------------gag-----ctggccccggggagggcccagcagctgacc
A0A2K5RUN8_BCL2L2-01       ------------gag-----ctggccccggggagggcccagcagctgacc
A0A2K5RUN8_BCL2L2-05       ------------ccc-----ggggccggtggggaggccggggagggggcc
A0A2K5RUN8_BCL2L2-02       ------------gag-----ctggccccggggagggcccagcagctgacc
A0A2K5RUN8_BCL2L2-04       ------------ccc-----ggggccggtggggaggccggggagggggcc
A0A2K5Q6R6_BCL2L1-03       ----------------------------------tggaagagaacaggac
A0A2K5PP81_BCL2-01         ------------a---------------------tgccggagatgtgggc
A0A2K5Q6R6_BCL2L1-01       ------------gtcagtttagtgatg-------tggaagagaacaggac
A0A2K5Q6R6_BCL2L1-02       ------------gtcagtttagtgatg-------tggaagagaacaggac
                                                                             

A0A2K5RIU7_BCL2L10-01      gccaccgccgccggtgtacggaaagtctaccggtccttcttctccg--cc
A0A2K5R5C4_MCL1-01         gccggcgcggtgattggcggaagcgtcgg-c-gctagcc-ccccggccgc
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         gccggcgcggtgattggcggaagcgtcgg-c-gctagcc-ccccggccgc
A0A2K5R5C4_MCL1-03         gccggcgcggtgattggcggaagcgtcgg-c-gctagcc-ccccggccgc
A0A2K5PYQ3_BCL2A1-01       -c------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       -c------------------------------------------------
A0A2K5RUN8_BCL2L2-03       -cgc----------------------------------------------
A0A2K5RUN8_BCL2L2-01       -cgc----------------------------------------------
A0A2K5RUN8_BCL2L2-05       ccgg----------------------------------------------
A0A2K5RUN8_BCL2L2-02       -cgc----------------------------------------------
A0A2K5RUN8_BCL2L2-04       ccgg----------------------------------------------
A0A2K5Q6R6_BCL2L1-03       tgaggccccagaagggactgattcggaga-t-ggagacc-cccagt--gc
A0A2K5PP81_BCL2-01         gccgcgcccc-caggggccgcccccgcgc-c-gggcatcttctcct--cc
A0A2K5Q6R6_BCL2L1-01       tgaggccccagaagggactgattcggaga-t-ggagacc-cccagt--gc
A0A2K5Q6R6_BCL2L1-02       tgaggccccagaagggactgattcggaga-t-ggagacc-cccagt--gc
                                                                             

A0A2K5RIU7_BCL2L10-01      tacctcg----------------------g--------------------
A0A2K5R5C4_MCL1-01         cctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcgccg
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         cctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcgccg
A0A2K5R5C4_MCL1-03         cctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcgccg
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       catcaa--------------------------------------------
A0A2K5PP81_BCL2-01         cagcccg----------------------ggcacacgcccggtcccgccg
A0A2K5Q6R6_BCL2L1-01       catcaat----------------------ggc--------------aacc
A0A2K5Q6R6_BCL2L1-02       catcaat----------------------ggc--------------aacc
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         aggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgccc
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         aggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgccc
A0A2K5R5C4_MCL1-03         aggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgccc
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         cgccccgggacccggtcgccaggacctcg---------------------
A0A2K5Q6R6_BCL2L1-01       catcctggcacctggcggacagccccgcg---------------------
A0A2K5Q6R6_BCL2L1-02       catcctggcacctggcggacagccccgcg---------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         acccgccgcgcggcgccgctt-gaggagatggaagccccggccgccgacg
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         acccgccgcgcggcgccgctt-gaggagatggaagccccggccgccgacg
A0A2K5R5C4_MCL1-03         acccgccgcgcggcgccgctt-gaggagatggaagccccggccgccgacg
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         ---------------ccgccg-tcgcccccggccgcccccgccgccgccg
A0A2K5Q6R6_BCL2L1-01       ---------------gtgaatggagccacgggccacagcagcagtttgga
A0A2K5Q6R6_BCL2L1-02       ---------------gtgaatggagccacgggccacagcagcagtttgga
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         ccatcatgtctcccgaagaagagctggacgggtacgagccagagcctctc
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         ccatcatgtctcccgaagaagagctggacgggtacgagccagagcctctc
A0A2K5R5C4_MCL1-03         ccatcatgtctcccgaagaagagctggacgggtacgagccagagcctctc
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         ccaccgggcctgc------gctca--------------------------
A0A2K5Q6R6_BCL2L1-01       t----gcccggga------ggtga--------------------------
A0A2K5Q6R6_BCL2L1-02       t----gcccggga------ggtga--------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         gggaagcggccggctgtcctgcccctgctggagttggtcggggagcctgg
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         gggaagcggccggctgtcctgcccctgctggagttggtcggggagcctgg
A0A2K5R5C4_MCL1-03         gggaagcggccggctgtcctgcccctgctggagttggtcggggagcctgg
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         -gcc----------------------------------------------
A0A2K5Q6R6_BCL2L1-01       -tcc----------------------------------------------
A0A2K5Q6R6_BCL2L1-02       -tcc----------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         taatggctccagtacggacgggtcactaccctcgacgccgccgccagcag
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         taatggctccagtacggacgggtcactaccctcgacgccgccgccagcag
A0A2K5R5C4_MCL1-03         taatggctccagtacggacgggtcactaccctcgacgccgccgccagcag
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         cggtgccacctg--------------------------------------
A0A2K5Q6R6_BCL2L1-01       ccatggcagcag--------------------------------------
A0A2K5Q6R6_BCL2L1-02       ccatggcagcag--------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         aggaggaggaggacgagttgtaccggcagtcgctggagattatctctcgg
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         aggaggaggaggacgagttgtaccggcagtcgctggagattatctctcgg
A0A2K5R5C4_MCL1-03         aggaggaggaggacgagttgtaccggcagtcgctggagattatctctcgg
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       --------------------------------------------------
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         taccttcgggagcaggcgaccg---gcgccaaggacacaaagccaatggg
A0A2K5R5C4_MCL1-04         ----------------cgaccg---gcgccaaggacacaaagccaatggg
A0A2K5R5C4_MCL1-02         taccttcgggagcaggcgaccg---gcgccaaggacacaaagccaatggg
A0A2K5R5C4_MCL1-03         taccttcgggagcaggcgaccg---gcgccaaggacacaaagccaatggg
A0A2K5PYQ3_BCL2A1-01       ---------------------g---ggtcca-------------------
A0A2K5PYQ3_BCL2A1-02       ---------------------g---ggtcca-------------------
A0A2K5RUN8_BCL2L2-03       ---------------------t---gcacca-------------------
A0A2K5RUN8_BCL2L2-01       ---------------------t---gcacca-------------------
A0A2K5RUN8_BCL2L2-05       ---------------------g---gggcgc-------------------
A0A2K5RUN8_BCL2L2-02       ---------------------t---gcacca-------------------
A0A2K5RUN8_BCL2L2-04       ---------------------g---gggcgc-------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         ---------------------tggtccacct-------------------
A0A2K5Q6R6_BCL2L1-01       ---------------------t---aaagca-------------------
A0A2K5Q6R6_BCL2L1-02       ---------------------t---aaagca-------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         caggtccggggccgccagcaggaaggctctggagaccttacgacgggtgg
A0A2K5R5C4_MCL1-04         caggtccggggccgccagcaggaaggctctggagaccttacgacgggtgg
A0A2K5R5C4_MCL1-02         caggtccggggccgccagcaggaaggctctggagaccttacgacgggtgg
A0A2K5R5C4_MCL1-03         caggtccggggccgccagcaggaaggctctggagaccttacgacgggtgg
A0A2K5PYQ3_BCL2A1-01       ---------------------------------agcaaaacgtccagagt
A0A2K5PYQ3_BCL2A1-02       ---------------------------------agcaaaacgtccagagt
A0A2K5RUN8_BCL2L2-03       ---------------------------------agcaatgcgggcagctg
A0A2K5RUN8_BCL2L2-01       ---------------------------------agcaatgcgggcagctg
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       ---------------------------------agcaatgcgggcagctg
A0A2K5RUN8_BCL2L2-04       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         ---------------------------------gaccctccgccaagccg
A0A2K5Q6R6_BCL2L1-01       ---------------------------------agcactgagggaggcgg
A0A2K5Q6R6_BCL2L1-02       ---------------------------------agcactgagggaggcgg
                                                                             

A0A2K5RIU7_BCL2L10-01      ----cta--ccccgggaaccgcgtcgagct---------------ggtgg
A0A2K5R5C4_MCL1-01         gggacgg--cgtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A2K5R5C4_MCL1-04         gggacgg--cgtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A2K5R5C4_MCL1-02         gggacgg--cgtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A2K5R5C4_MCL1-03         gggacgg--cgtgcagcgcaaccacgagacggccttccaag---------
A0A2K5PYQ3_BCL2A1-01       gctacaaaaggttgcattct-----cagtccaaaagccatgct-tggaca
A0A2K5PYQ3_BCL2A1-02       gctacaaaaggttgcattct-----cagtccaaaagccatgct-tggaca
A0A2K5RUN8_BCL2L2-03       gagatga--gttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5RUN8_BCL2L2-01       gagatga--gttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5RUN8_BCL2L2-05       -agggga--ctacgggaacggcctggagtctgaggaactggagcctgagg
A0A2K5RUN8_BCL2L2-02       gagatga--gttcgagacccgcttccggcgcaccttctctgatctggcgg
A0A2K5RUN8_BCL2L2-04       -agggga--ctacgggaacggcctggagtctgaggaactggagcctgagg
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         gcgacga--cttctcccgccgctaccgccgcgacttcgccgagatgtcca
A0A2K5Q6R6_BCL2L1-01       gcgacga--gtttgaactgcggtaccggcgggcatttagtgacctgacat
A0A2K5Q6R6_BCL2L1-02       gcgacga--gtttgaactgcggtaccggcgggcatttagtgacctgacat
                                                                             

A0A2K5RIU7_BCL2L10-01      cgaggatggcggaggcgctgctctc-------------------------
A0A2K5R5C4_MCL1-01         ggaaactggacatcaaaaacga-agacgatgt------caaatctttgtc
A0A2K5R5C4_MCL1-04         ggaaactggacatcaaaaacga-agacgatgt------caaatctttgtc
A0A2K5R5C4_MCL1-02         ggaaactggacatcaaaaacga-agacgatgt------caaatctttgtc
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       atgttaatattgtgtccatagataatgccaga------acgatattc-ag
A0A2K5PYQ3_BCL2A1-02       atgttaatattgtgtccatagataatgccaga------acgatattc-ag
A0A2K5RUN8_BCL2L2-03       ctcagctgcatgtgaccccaggctcagcccaa------caacgcttc-ac
A0A2K5RUN8_BCL2L2-01       ctcagctgcatgtgaccccaggctcagcccaa------caacgcttc-ac
A0A2K5RUN8_BCL2L2-05       a-------------------------------------------------
A0A2K5RUN8_BCL2L2-02       ctcagctgcatgtgaccccaggctcagcccaa------caacgcttc-ac
A0A2K5RUN8_BCL2L2-04       agctgctgctggag-cccgagccggagcccgagcctgaagaggagcc-gc
A0A2K5Q6R6_BCL2L1-03       ---tgctccacatcacccccgggacagcatat------caaagcttt-ga
A0A2K5PP81_BCL2-01         gccagctgcacctgacgcccttcaccgcgcgg------ggacgcttt-gc
A0A2K5Q6R6_BCL2L1-01       cccagctccacatcacccccgggacagcatat------caaagcttt-ga
A0A2K5Q6R6_BCL2L1-02       cccagctccacatcacccccgggacagcatat------caaagcttt-ga
                                                                             

A0A2K5RIU7_BCL2L10-01      ---------------------cgacagtcccggccccacctggggcaacg
A0A2K5R5C4_MCL1-01         tcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtagga
A0A2K5R5C4_MCL1-04         tcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtagga
A0A2K5R5C4_MCL1-02         tcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtagga
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       tcaagtgatggaaacggaatttgaagatggcattattaactggggaagaa
A0A2K5PYQ3_BCL2A1-02       tcaagtgatggaaacggaatttgaagatggcattattaactggggaagaa
A0A2K5RUN8_BCL2L2-03       ccaggtctccgatgaacttttccaa---gggggccccaactggggccgcc
A0A2K5RUN8_BCL2L2-01       ccaggtctccgatgaacttttccaa---gggggccccaactggggccgcc
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       ccaggtctccgatgaacttttccaa---gggggccccaactggggccgcc
A0A2K5RUN8_BCL2L2-04       cccggcc---------------------------------ccgcgccccc
A0A2K5Q6R6_BCL2L1-03       acaagtagtgaacgaactcttccgg---gatggggtaaactggggtcgca
A0A2K5PP81_BCL2-01         cacggtggtggaggagctcttcagg---gacggggtgaactgggggagga
A0A2K5Q6R6_BCL2L1-01       acaagtagtgaacgaactcttccgg---gatggggtaaactggggtcgca
A0A2K5Q6R6_BCL2L1-02       acaagtagtgaacgaactcttccgg---gatggggtaaactggggtcgca
                                                                             

A0A2K5RIU7_BCL2L10-01      tggtgatgcttctggccttcgcggggacgctgctag------a-------
A0A2K5R5C4_MCL1-01         ttgtgactctcatttattttggtgcctttgtggccaaacacttgaagacc
A0A2K5R5C4_MCL1-04         ttgtgactctcatttattttggtgcctttgtggccaaacacttgaagacc
A0A2K5R5C4_MCL1-02         ttgtgactctcatttattttggtgcctttgtggccaaacacttgaagacc
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       ttgtaaccatatttgcatttgaaggtattctcatca------agaaactt
A0A2K5PYQ3_BCL2A1-02       ttgtaaccatatttgcatttgaaggtattctcatca------agaaactt
A0A2K5RUN8_BCL2L2-03       ttgtagccttctttgtctttggggctgcactgtgtg------ctgagagt
A0A2K5RUN8_BCL2L2-01       ttgtagccttctttgtctttggggctgcactgtgtg------ctgagagt
A0A2K5RUN8_BCL2L2-05       --------------------------------------------------
A0A2K5RUN8_BCL2L2-02       ttgtagccttctttgtctttggggctgcactgtgtg------ctgagagt
A0A2K5RUN8_BCL2L2-04       ccgggagct-cc-gggccctgggcctggttc-------------------
A0A2K5Q6R6_BCL2L1-03       ttgtggcctttttctccttcggcggggcactgtgcg------tggaaagc
A0A2K5PP81_BCL2-01         ttgtggccttctttgagttcggtggggtcatgtgtg------tggagagc
A0A2K5Q6R6_BCL2L1-01       ttgtggcctttttctccttcggcggggcactgtgcg------tggaaagc
A0A2K5Q6R6_BCL2L1-02       ttgtggcctttttctccttcggcggggcactgtgcg------tggaaagc
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         ataaaccaag----------aaagctg------cattgaaccattagcag
A0A2K5R5C4_MCL1-04         ataaaccaag----------aaagctg------cattgaaccattagcag
A0A2K5R5C4_MCL1-02         ataaaccaag----------aaagctg------cattgaaccattagcag
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       ctacaagagcgaattgccccggatgtggatacttataagga-gatttcgt
A0A2K5PYQ3_BCL2A1-02       ctacaagagcgaattgccccggatgtggatacttataagga-gatttcgt
A0A2K5RUN8_BCL2L2-03       gtcaacaagg----------agatggaaccactggtgggacaagtgcagg
A0A2K5RUN8_BCL2L2-01       gtcaacaagg----------agatggaaccactggtgggacaagtgcagg
A0A2K5RUN8_BCL2L2-05       ---------------------------------------tcaagaggagg
A0A2K5RUN8_BCL2L2-02       gtcaacaagg----------agatggaaccactggtgggacaagtgcagg
A0A2K5RUN8_BCL2L2-04       -----------------------gggagccccc-ggcagtcaagaggagg
A0A2K5Q6R6_BCL2L1-03       gtagacaagg----------agatgcaggtattggtgagtcggatcgcag
A0A2K5PP81_BCL2-01         gtcaaccggg----------agatgtcgcccctggtggacaacatcgccc
A0A2K5Q6R6_BCL2L1-01       gtagacaagg----------agatgcaggtattggtgagtcggatcgcag
A0A2K5Q6R6_BCL2L1-02       gtagacaagg----------agatgcaggtattggtgagtcggatcgcag
                                                                             

A0A2K5RIU7_BCL2L10-01      -----------------------------------------gagggggcc
A0A2K5R5C4_MCL1-01         aaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaa
A0A2K5R5C4_MCL1-04         aaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaa
A0A2K5R5C4_MCL1-02         aaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaa
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       attttgttgctgagtacataatgaataacacaggagaatggataagacaa
A0A2K5PYQ3_BCL2A1-02       attttgttgctgagtacataatgaataacacaggagaatggataagacaa
A0A2K5RUN8_BCL2L2-03       agtggatggtggcctacctggagacgcggctggccgactggatccacagc
A0A2K5RUN8_BCL2L2-01       agtggatggtggcctacctggagacgcggctggccgactggatccacagc
A0A2K5RUN8_BCL2L2-05       aggaggagccggga---c--tggtcgagggtgacccgg-gggacggcgcc
A0A2K5RUN8_BCL2L2-02       agtggatggtggcctacctggagacgcggctggccgactggatccacagc
A0A2K5RUN8_BCL2L2-04       aggaggagccggga---c--tggtcgagggtgacccgg-gggacggcgcc
A0A2K5Q6R6_BCL2L1-03       cttggatggccacttacctgaatgaccacctagagccttggatccaggag
A0A2K5PP81_BCL2-01         tgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggat
A0A2K5Q6R6_BCL2L1-01       cttggatggccacttacctgaatgaccacctagagccttggatccaggag
A0A2K5Q6R6_BCL2L1-02       cttggatggccacttacctgaatgaccacctagagccttggatccaggag
                                                                             

A0A2K5RIU7_BCL2L10-01      gctggtgaccgccc-ggtggaagaagtggggcttccagtcgc---ggctg
A0A2K5R5C4_MCL1-01         caaagaggctggga-tggg------tttgtggagttcttccatgtag-ag
A0A2K5R5C4_MCL1-04         caaagaggctggga-tggg------tttgtggagttcttccatgtag-ag
A0A2K5R5C4_MCL1-02         caaagaggctggga-tggg------tttgtggagttcttccatgtag-ag
A0A2K5R5C4_MCL1-03         ------------ga-tggg------tttgtggagttcttccatgtag-ag
A0A2K5PYQ3_BCL2A1-01       aacggaggctggga-aaat------gg-----------------------
A0A2K5PYQ3_BCL2A1-02       aacggaggctgggggaaat------gg-----------------------
A0A2K5RUN8_BCL2L2-03       agtgggggctggga-gctggaagctatcaaagctcgagtcag---gg-ag
A0A2K5RUN8_BCL2L2-01       agtgggggctgggc-ggag------ttcacagctctatacgg---gg-ac
A0A2K5RUN8_BCL2L2-05       attgaggacccgga-gctggaagctatcaaagctcgagtcag---gg-ag
A0A2K5RUN8_BCL2L2-02       agtgggggctgggc-ggag------ttcacagctctatacgg---gg-ac
A0A2K5RUN8_BCL2L2-04       attgaggacccgga-gctggaagctatcaaagctcgagtcag---gg-ag
A0A2K5Q6R6_BCL2L1-03       aacggcggctggga-cact------tttgtggaactctatgg---aa-ac
A0A2K5PP81_BCL2-01         aacggaggctggga-tgcc------tttgtggaactgtatgg---cc-cc
A0A2K5Q6R6_BCL2L1-01       aacggcggctggga-cact------tttgtggaactctatgg---aa-ac
A0A2K5Q6R6_BCL2L1-02       aacggcggctggga-cact------tttgtggaactctatgg---aa-ac
                                                                             

A0A2K5RIU7_BCL2L10-01      aa--ggagccggagggcaacgtctcccgggaccgccagcgcctggtgggc
A0A2K5R5C4_MCL1-01         ga--c---------------------------------------------
A0A2K5R5C4_MCL1-04         ga--c---------------------------------------------
A0A2K5R5C4_MCL1-02         ga--c---------------------------------------------
A0A2K5R5C4_MCL1-03         ga--c---------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       at--ggaggaagaagctgagaagctaaaggaactacagaacgaggtagag
A0A2K5RUN8_BCL2L2-01       gg--g---------------------------------------------
A0A2K5RUN8_BCL2L2-05       at--ggaggaagaagctgagaagctaaaggaactacagaacgaggtagag
A0A2K5RUN8_BCL2L2-02       gg--g---------------------------------------------
A0A2K5RUN8_BCL2L2-04       at--ggaggaagaagctgagaagctaaaggaactacagaacgaggtagag
A0A2K5Q6R6_BCL2L1-03       aa--t---------------------------------------------
A0A2K5PP81_BCL2-01         agcat---------------------------------------------
A0A2K5Q6R6_BCL2L1-01       aa--t---------------------------------------------
A0A2K5Q6R6_BCL2L1-02       aa--t---------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      ttgctgagctcgcggctcgtggggcagcaccgtgcc--------------
A0A2K5R5C4_MCL1-01         --------------------------------------------------
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         --------------------------------------------------
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       aagcagatga-----atatgagtccacctccaggcaatgctggcccagtg
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       aagcagatga-----atatgagtccacctccaggcaatgctggcccagtg
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       aagcagatga-----atatgagtccacctccaggcaatgctggcccagtg
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      ------------------tggctggaggctcagggcggctgggtga--gc
A0A2K5R5C4_MCL1-01         --------------------------------------------------
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         --------------------------------------------------
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       atcatgtccattgaggagaagatggaggctgatgcccgttccatctatgt
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       atcatgtccattgaggagaagatggaggctgatgcccgttccatctatgt
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       atcatgtccattgaggagaagatggaggctgatgcccgttccatctatgt
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      acgcggagggggacacggggcgggatgggcacccgggaagggctcaccca
A0A2K5R5C4_MCL1-01         --------------------------------------------------
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         --------------------------------------------------
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       tggcaatgtggactacggtgcaacagca--------gaagagctgg-aag
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       tggcaatgtggactacggtgcaacagca--------gaagagctgg-aag
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       tggcaatgtggactacggtgcaacagca--------gaagagctgg-aag
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      cgtgcccagatggcttttgttacttct-----------------------
A0A2K5R5C4_MCL1-01         --------------------------------------------------
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         --------------------------------------------------
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------------------------------------------------
A0A2K5R5C4_MCL1-01         --------------------------------------------------
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         --------------------------------------------------
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      --------tcaggac-------ctcctactcactggcattatggagaaaa
A0A2K5R5C4_MCL1-01         ----------------------ctagaaggtggca---------------
A0A2K5R5C4_MCL1-04         ----------------------ctagaaggtggca---------------
A0A2K5R5C4_MCL1-02         ----------------------ctagaaggtggag---------------
A0A2K5R5C4_MCL1-03         ----------------------ctagaaggtggca---------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       agagtcagtgaggacttccttggccttagacgagt-ccctatttagagga
A0A2K5RUN8_BCL2L2-01       ----------------------gccctggaggagg-cgc-----------
A0A2K5RUN8_BCL2L2-05       agagtcagtgaggacttccttggccttagacgagt-ccctatttagagga
A0A2K5RUN8_BCL2L2-02       ----------------------gccctggaggagg-cgc-----------
A0A2K5RUN8_BCL2L2-04       agagtcagtgaggacttccttggccttagacgagt-ccctatttagagga
A0A2K5Q6R6_BCL2L1-03       ----------------------gcggcagccgaga-gcc-----------
A0A2K5PP81_BCL2-01         ----------------------gcggcc----------------------
A0A2K5Q6R6_BCL2L1-01       ----------------------gcggcagccgaga-gcc-----------
A0A2K5Q6R6_BCL2L1-02       ----------------------gcggcagccgaga-gcc-----------
                                                                             

A0A2K5RIU7_BCL2L10-01      ttgctggtccag--------------------------------------
A0A2K5R5C4_MCL1-01         --------------------------------------------------
A0A2K5R5C4_MCL1-04         --------------------------------------------------
A0A2K5R5C4_MCL1-02         --------------------------------------------------
A0A2K5R5C4_MCL1-03         --------------------------------------------------
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       aggcaaatcaaggttgacgttaaggctttcatttattcatctctgactca
A0A2K5RUN8_BCL2L2-01       --------------------------------------------------
A0A2K5RUN8_BCL2L2-05       aggcaaatcaag--------------------------------------
A0A2K5RUN8_BCL2L2-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-04       aggcaaatcaag--------------------------------------
A0A2K5Q6R6_BCL2L1-03       --------------------------------------------------
A0A2K5PP81_BCL2-01         --------------------------------------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------------------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      -gttttcctgtcatggttgttaacagcag---------------------
A0A2K5R5C4_MCL1-01         -----------------------------------------tcag-----
A0A2K5R5C4_MCL1-04         -----------------------------------------tcag-----
A0A2K5R5C4_MCL1-02         -----------------------------------------attg-----
A0A2K5R5C4_MCL1-03         -----------------------------------------tcag-----
A0A2K5PYQ3_BCL2A1-01       --------------------------------------------------
A0A2K5PYQ3_BCL2A1-02       --------------------------------------------------
A0A2K5RUN8_BCL2L2-03       ggtgatcccaaaacgaaccaacagaccaggca---------tcagcacaa
A0A2K5RUN8_BCL2L2-01       ----------------------------ggcg---------tctg-----
A0A2K5RUN8_BCL2L2-05       -gtgatcccaaaacgaaccaacagaccaggca---------tcagcacaa
A0A2K5RUN8_BCL2L2-02       ----------------------------ggcg---------tctg-----
A0A2K5RUN8_BCL2L2-04       -gtgatcccaaaacgaaccaacagaccaggca---------tcagcacaa
A0A2K5Q6R6_BCL2L1-03       ----------------------------gaaagggccaggagcgc-----
A0A2K5PP81_BCL2-01         -----------------------------------------tctg-----
A0A2K5Q6R6_BCL2L1-01       ----------------------------gaaagggccaggagcgc-----
A0A2K5Q6R6_BCL2L1-02       ----------------------------gaaagggccaggagcgc-----
                                                                             

A0A2K5RIU7_BCL2L10-01      ---------------------------------------------cattc
A0A2K5R5C4_MCL1-01         -----------------aa-------------------------------
A0A2K5R5C4_MCL1-04         -----------------aa-------------------------------
A0A2K5R5C4_MCL1-02         -----------------ca-------------------------------
A0A2K5R5C4_MCL1-03         -----------------aa-------------------------------
A0A2K5PYQ3_BCL2A1-01       ---------------------------------------ct---------
A0A2K5PYQ3_BCL2A1-02       ---------------------------------------ca---------
A0A2K5RUN8_BCL2L2-03       cagaccggggttttccacgagcccgctaccgggcacggaccaccaactac
A0A2K5RUN8_BCL2L2-01       -----------------cggga-------ggggaactgggca--------
A0A2K5RUN8_BCL2L2-05       cagaccggggttttccacgagcccgctaccgggcacggaccaccaactac
A0A2K5RUN8_BCL2L2-02       -----------------cggga-------ggggaactgggca--------
A0A2K5RUN8_BCL2L2-04       cagaccggggttttccacgagcccgctaccgggcacggaccaccaactac
A0A2K5Q6R6_BCL2L1-03       -----------------ttcaa-------ccgctggttcctg--------
A0A2K5PP81_BCL2-01         -----------------ttcga-------tttctcctggctg--------
A0A2K5Q6R6_BCL2L1-01       -----------------ttcaa-------ccgctggttcctg--------
A0A2K5Q6R6_BCL2L1-02       -----------------ttcaa-------ccgctggttcctg--------
                                                                             

A0A2K5RIU7_BCL2L10-01      atctacttctg-gacacgataattagga-gttttaaa--att--------
A0A2K5R5C4_MCL1-01         -----atgtgc-tgctggcttttgcaggtgttgctgg--agtaggagctg
A0A2K5R5C4_MCL1-04         -----atgtgc-tgctggcttttgcaggtgttgctgg--agtaggagctg
A0A2K5R5C4_MCL1-02         -----gtgatcatgccactgtgctccagcctggcaac--agagcgagatt
A0A2K5R5C4_MCL1-03         -----atgtgc-tgctggcttttgcaggtgttgctgg--agtaggagctg
A0A2K5PYQ3_BCL2A1-01       -------------------ttgtaaagaagtttgaacctaaatctggctg
A0A2K5PYQ3_BCL2A1-02       ---------------------------cagtctcatgcttatgctagtag
A0A2K5RUN8_BCL2L2-03       aacagttcccg-ctctcgattctacagtggttttaac--agcaggccccg
A0A2K5RUN8_BCL2L2-01       --------------------------tcagtgaggac--agtgctgacag
A0A2K5RUN8_BCL2L2-05       aacagttcccg-ctctcgattctacagtggttttaac--agcaggccccg
A0A2K5RUN8_BCL2L2-02       --------------------------tcagtgaggac--agtgctgacag
A0A2K5RUN8_BCL2L2-04       aacagttcccg-ctctcgattctacagtggttttaac--agcaggccccg
A0A2K5Q6R6_BCL2L1-03       --------------------------acg---------------------
A0A2K5PP81_BCL2-01         --------------------------tct---------------------
A0A2K5Q6R6_BCL2L1-01       --------------------------acg---------------------
A0A2K5Q6R6_BCL2L1-02       --------------------------acg---------------------
                                                                             

A0A2K5RIU7_BCL2L10-01      ------------------------------tttagcccacttc-------
A0A2K5R5C4_MCL1-01         g------------------------------------tttggc-------
A0A2K5R5C4_MCL1-04         g------------------------------------tttggc-------
A0A2K5R5C4_MCL1-02         c------------------------------------cttctc-------
A0A2K5R5C4_MCL1-03         g------------------------------------tttggc-------
A0A2K5PYQ3_BCL2A1-01       gatgacttttctagaagtcacaggaaa-gatctgtgaaatgct-------
A0A2K5PYQ3_BCL2A1-02       agtcagtggcccagaagaagaggaaaa-tggctttg--------------
A0A2K5RUN8_BCL2L2-03       gggtcgc-gtctacaggggccgggcta-gagcgacatcatggt-------
A0A2K5RUN8_BCL2L2-01       gggccgt-ggcactgggggccctggtaactgtaggggcctttt-------
A0A2K5RUN8_BCL2L2-05       gggtcgc-gtctacaggggccgggcta-gagcgacatcatggt-------
A0A2K5RUN8_BCL2L2-02       gggccgt-ggcactgggggccctggtaactgtaggggcctttt-------
A0A2K5RUN8_BCL2L2-04       gggtcgc-gtctacaggggccgggcta-gagcgacatcatggt-------
A0A2K5Q6R6_BCL2L1-03       --ggcat-gactgtggccggcgtggttctgctgggctcactct-------
A0A2K5PP81_BCL2-01         --ctgaa-gactctgctcagcttggccctggtgggagcttgcatcaccct
A0A2K5Q6R6_BCL2L1-01       --ggcat-gactgtggccggcgtggttctgctgggctcactct-------
A0A2K5Q6R6_BCL2L1-02       --ggcat-gactgtggccggcgtggttctgctgggctcactct-------
                                                                             

A0A2K5RIU7_BCL2L10-01      -------tac-ctgcccaa-----ctgt--------ga
A0A2K5R5C4_MCL1-01         at---------atctaata-----agat--------ag
A0A2K5R5C4_MCL1-04         at---------atctaata-----agat--------ag
A0A2K5R5C4_MCL1-02         aa---------aaaaagaaaaaggagct--------ga
A0A2K5R5C4_MCL1-03         at---------atctaata-----agatagccttgtaa
A0A2K5PYQ3_BCL2A1-01       atctctcttgaagcaatac-----tatt--------ga
A0A2K5PYQ3_BCL2A1-02       ---------------------------t--------aa
A0A2K5RUN8_BCL2L2-03       -----------attcccct-----tact--------aa
A0A2K5RUN8_BCL2L2-01       -----------ttgctagc-----aagt--------ga
A0A2K5RUN8_BCL2L2-05       -----------attcccct-----tact--------aa
A0A2K5RUN8_BCL2L2-02       -----------ttgctagc-----aagt--------ga
A0A2K5RUN8_BCL2L2-04       -----------attcccct-----tact--------aa
A0A2K5Q6R6_BCL2L1-03       -----------ttagtcgg-----aaat--------ga
A0A2K5PP81_BCL2-01         gggtgcctatctgggccac-----aaat--------ga
A0A2K5Q6R6_BCL2L1-01       -----------ttagtcgg-----aaat--------ga
A0A2K5Q6R6_BCL2L1-02       -----------ttagtcgg-----aaat--------ga
                                                      *          

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice