Dataset for CDS BCL-2-like of organism Apteryx owenii

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9S513_BCL2A1-      -----atgga----------------------------------------
A0A8B9NWH6_BCL2L1-      -----atgtc----------------------------------------
A0A8B9NWH6_BCL2L1-      -----atgtc----------------------------------------
A0A8B9P3N9_MCL1-01      tccccgtggcttttcccacatgctcccacgtcctttggggcgggcgcgat
A0A8B9PRT7_BCL2-01      -----atggctcatcc----------------------------------
A0A8B9PRT7_BCL2-02      -----atggctcatcc----------------------------------

A0A8B9S513_BCL2A1-      --------------------------------aaccgctgagttttatta
A0A8B9NWH6_BCL2L1-      ----------------------------cagcagtaaccgggaattagtg
A0A8B9NWH6_BCL2L1-      ----------------------------cagcagtaaccgggaattagtg
A0A8B9P3N9_MCL1-01      tttgcgccagccacgtgcggggagggagcgaagggcggcagggcgaagtg
A0A8B9PRT7_BCL2-01      ----------------ggggagaagaggctacgataaccgggagatagtg
A0A8B9PRT7_BCL2-02      ----------------ggggagaagaggctacgataaccgggagatagtg
                                                                 *    * * 

A0A8B9S513_BCL2A1-      c-------------------------------gtttattattt---agct
A0A8B9NWH6_BCL2L1-      attga---------------------------ctttgtttcctacaagct
A0A8B9NWH6_BCL2L1-      attga---------------------------ctttgtttcctacaagct
A0A8B9P3N9_MCL1-01      caggaggcctggcctccgctggggatcgccgtgtggatccctggaaagtc
A0A8B9PRT7_BCL2-01      ctgaa---------------------------gtacatccattataaact
A0A8B9PRT7_BCL2-02      ctgaa---------------------------gtacatccattataaact
                                                         *   *        *   

A0A8B9S513_BCL2A1-      cac-----------------------------------------------
A0A8B9NWH6_BCL2L1-      ctcacagaagggatacagctgga--gtcagctcgaggaagaggatgagaa
A0A8B9NWH6_BCL2L1-      ctcacagaagggatacagctgga--gtcagctcgaggaagaggatgagaa
A0A8B9P3N9_MCL1-01      cgcagagatgggaaaccgcaagg--gccgtt---ggcagggggatcccaa
A0A8B9PRT7_BCL2-01      ctcgcagaggggatacgactgggctgccagc---ggcgaccgggcgccag
A0A8B9PRT7_BCL2-02      ctcgcagaggggatacgactgggctgccagc---ggcgaccgggcgccag
                        * *                                               

A0A8B9S513_BCL2A1-      ------------------------------------------gattatct
A0A8B9NWH6_BCL2L1-      c------agga-----------------------------ctgattttgc
A0A8B9NWH6_BCL2L1-      c------agga-----------------------------ctgattttgc
A0A8B9P3N9_MCL1-01      ag-----agaaaccccccccgctgcagctggcgtgcggctctgctcacta
A0A8B9PRT7_BCL2-01      cgtctccagggctctctcctcctgctgctg----------ctgctctt--
A0A8B9PRT7_BCL2-02      cgtctccagggctctctcctcctgctgctg----------ctgctctt--
                                                                  * *     

A0A8B9S513_BCL2A1-      gcagtatgtt----------------------------------------
A0A8B9NWH6_BCL2L1-      ggtagaggct----------------------------------------
A0A8B9NWH6_BCL2L1-      ggtagaggct----------------------------------------
A0A8B9P3N9_MCL1-01      gcaggatgctcggctcgaaggcagccggatttgggatgcgtcgaggttag
A0A8B9PRT7_BCL2-01      ----gctgct----------------------------------------
A0A8B9PRT7_BCL2-02      ----gctgct----------------------------------------
                               * *                                        

A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      -------------------------------------------------g
A0A8B9NWH6_BCL2L1-      -------------------------------------------------g
A0A8B9P3N9_MCL1-01      ggagcagggcacgaagcacagcaggggcagaccagaacgagacggcgccg
A0A8B9PRT7_BCL2-01      ----------------------------------------------gctg
A0A8B9PRT7_BCL2-02      ----------------------------------------------gctg

A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      ggat--------------------------------ggccggtgtcctta
A0A8B9NWH6_BCL2L1-      ggat--------------------------------ggccggtgtcctta
A0A8B9P3N9_MCL1-01      cgaatcccccaaaacgagccaaaccgtatcccagcgggtcggcgcctccc
A0A8B9PRT7_BCL2-01      ggacttcctctg---------------atcacactgggctggtgtct---
A0A8B9PRT7_BCL2-02      ggacttcctctg---------------atcacactgggctggtgtct---

A0A8B9S513_BCL2A1-      ---------------------------------------------cttca
A0A8B9NWH6_BCL2L1-      atgggagcccatcctggca---------------------cccccctgct
A0A8B9NWH6_BCL2L1-      atgggagcccatcctggca---------------------cccccctgct
A0A8B9P3N9_MCL1-01      gcttttccccggaatggtatttccccacgtctacgtgatgccgctcacca
A0A8B9PRT7_BCL2-01      ----------------------------------------ccgcaccccg
A0A8B9PRT7_BCL2-02      ----------------------------------------ccgcaccccg
                                                                     *  * 

A0A8B9S513_BCL2A1-      agaatcaca-----------------------------ccttggaccagc
A0A8B9NWH6_BCL2L1-      agccacata---gtgaacggagccgctg--------tgcacaggagcagc
A0A8B9NWH6_BCL2L1-      agccacata---gtgaacggagccgctg--------tgcacaggagcagc
A0A8B9P3N9_MCL1-01      ggccgctcgctccggagccgatcggctcgttccgggtgcaccggggccgc
A0A8B9PRT7_BCL2-01      agccccccg----------gctcggctgctgctagtaac------gcggc
A0A8B9PRT7_BCL2-02      agccccccg----------gctcggctgctgctagtaac------gcggc
                         *   *                                *       * **

A0A8B9S513_BCL2A1-      ccaa-------------------------accagag----ttgctcacgt
A0A8B9NWH6_BCL2L1-      ctcgaagtccatgaaattgttcaagca--gctgacg----tgaggcaggc
A0A8B9NWH6_BCL2L1-      ctcgaagtccatgaaattgttcaagca--gctgacg----tgaggcaggc
A0A8B9P3N9_MCL1-01      ccgg-cgtcgacgagctgcgccaggactcgctggagctcatcggccgcta
A0A8B9PRT7_BCL2-01      cccg-ggt-gacgggctgcgcccggcgccaccggtg---gtccacctcgc
A0A8B9PRT7_BCL2-02      cccg-ggt-gacgggctgcgcccggcgccaccggtg---gtccacctcgc
                        *                             *    *    *    *    

A0A8B9S513_BCL2A1-      cctgcgaaacattgcattt----tcactgcaagatcaaacagaggaggct
A0A8B9NWH6_BCL2L1-      actgagagaggcgggagatgaatttgagtt--gaggtaccggagagcttt
A0A8B9NWH6_BCL2L1-      actgagagaggcgggagatgaatttgagtt--gaggtaccggagagcttt
A0A8B9P3N9_MCL1-01      cctgcgggaggcggcgggcgaagccgagcccggcgcta--agaagctctt
A0A8B9PRT7_BCL2-01      cctgcgccaagccggggatgagttc--tcccgccgctaccagagggactt
A0A8B9PRT7_BCL2-02      cctgcgccaagccggggatgagttc--tcccgccgctaccagagggactt
                         *** *  *    *                       *   **      *

A0A8B9S513_BCL2A1-      c-----------------tccgaccattcttggataggattgatatta--
A0A8B9NWH6_BCL2L1-      c------------agtgacctcact--tcccagct---------------
A0A8B9NWH6_BCL2L1-      c------------agtgacctcact--tcccagct---------------
A0A8B9P3N9_MCL1-01      cccggggctgctgggcggcccgggtaggcccggcggggcgggcgacggcg
A0A8B9PRT7_BCL2-01      c----------------gcccaaat--gtctggccagct-----------
A0A8B9PRT7_BCL2-02      c----------------gcccaaat--gtctggccagct-----------
                        *                  *            *                 

A0A8B9S513_BCL2A1-      -----------cctctgtagatgttgc-----------------------
A0A8B9NWH6_BCL2L1-      -----------ccacatcacccctggc------------actgcgtat--
A0A8B9NWH6_BCL2L1-      -----------ccacatcacccctggc------------actgcgtat--
A0A8B9P3N9_MCL1-01      tcatggagaaggcgctggagacgctgcggcgggtcggcaacggcgtcatg
A0A8B9PRT7_BCL2-01      -----------gcacctgacacccttc------------acggc------
A0A8B9PRT7_BCL2-02      -----------gcacctgacacccttc------------acggc------
                                    * *   *       *                       

A0A8B9S513_BCL2A1-      caagcga--------attttcaatgga-----------------------
A0A8B9NWH6_BCL2L1-      caga-----------gcttt------------------------------
A0A8B9NWH6_BCL2L1-      caga-----------gcttt------------------------------
A0A8B9P3N9_MCL1-01      cagaagcacgagctcgccttccaaggaatgctgcggaagctggaaatcaa
A0A8B9PRT7_BCL2-01      cagaggc-------cgcttt------------------------------
A0A8B9PRT7_BCL2-02      cagaggc-------cgcttt------------------------------
                        **                **                              

A0A8B9S513_BCL2A1-      ----------------------------gtcatggaagaaa---aatttg
A0A8B9NWH6_BCL2L1-      ----------------------gagcaggtggtgaacgaac---tcttcc
A0A8B9NWH6_BCL2L1-      ----------------------gagcaggtggtgaacgaac---tcttcc
A0A8B9P3N9_MCL1-01      gaaggaggaagacctgcagtcagtgtgtgaggtggcagcccatgttttca
A0A8B9PRT7_BCL2-01      ----------------------gtggccgtggtggaggagc---tcttcc
A0A8B9PRT7_BCL2-02      ----------------------gtggccgtggtggaggagc---tcttcc
                                                    *   **   *        **  

A0A8B9S513_BCL2A1-      ctgatggaaatactaactggggacgaatcatgaccatatttacatttgga
A0A8B9NWH6_BCL2L1-      gggacggagt---gaactggggtcgcatcgtggctttcttctccttcgga
A0A8B9NWH6_BCL2L1-      gggacggagt---gaactggggtcgcatcgtggctttcttctccttcgga
A0A8B9P3N9_MCL1-01      gtgatggagtaacaaactggggcagagttgtgacactcatctcatttggt
A0A8B9PRT7_BCL2-01      gagacggggt---caactgggggagaatcgtggccttcttcgagttcggc
A0A8B9PRT7_BCL2-02      gagacggggt---caactgggggagaatcgtggccttcttcgagttcggc
                          ** **       ********  *  *  ** *  *  *    ** ** 

A0A8B9S513_BCL2A1-      ggacttctcactaagaagcttcaagagcatggagttcagctcacaggaga
A0A8B9NWH6_BCL2L1-      ggggcgtt------g-tgcgtggagagcgttga---------caaggaga
A0A8B9NWH6_BCL2L1-      ggggcgtt------g-tgcgtggagagcgttga---------caaggaga
A0A8B9P3N9_MCL1-01      gcctttgttgcaaaa-cacctgaaaagcataaa---------ccaggaga
A0A8B9PRT7_BCL2-01      agcgtcat------g-tgcgtggagagcgtcaa---------ccgggaga
A0A8B9PRT7_BCL2-02      agcgtcat------g-tgcgtggagagcgtcaa---------ccgggaga
                               *          * *  * *** *  *            *****

A0A8B9S513_BCL2A1-      gga-------------gaaggagcagatttcttatttcatcacagagtac
A0A8B9NWH6_BCL2L1-      tgc------gggtattggttggacgcgttgtatcttggatgaccacgt--
A0A8B9NWH6_BCL2L1-      tgc------gggtattggttggacgcgttgtatcttggatgaccacgt--
A0A8B9P3N9_MCL1-01      agtgcatcagctcattagcagggatcatcac-----agatgctcttgtct
A0A8B9PRT7_BCL2-01      tgt------cccccctggtggacagcattgccacctggatgaccgagt--
A0A8B9PRT7_BCL2-02      tgt------cccccctggtggacagcattgccacctggatgaccgagt--
                         *                  *      *          **      **  

A0A8B9S513_BCL2A1-      atcataaacaacaa---agctgaatggatagatgcaaacggtggctggga
A0A8B9NWH6_BCL2L1-      -acttgaccgaccatctagacccctggatccaagagaatggcggatggga
A0A8B9NWH6_BCL2L1-      -acttgaccgaccatctagacccctggatccaagagaatggcggatggga
A0A8B9P3N9_MCL1-01      catctaaacgagag----------tggctgatgagccaaggaggctggga
A0A8B9PRT7_BCL2-01      -acctgaaccggcacctgcatacttggatccaggacaacggcggctgg--
A0A8B9PRT7_BCL2-02      -acctgaaccggcacctgcatacttggatccaggacaacggcggctggca
                            * * *               *** *        * ** ** ***  

A0A8B9S513_BCL2A1-      aaa------cggcttcc------------------------tgacaaagt
A0A8B9NWH6_BCL2L1-      gcggtttgtggacctctacgggaatgatgctgctgccgagatgaggaag-
A0A8B9NWH6_BCL2L1-      gcggtttgtggacctctacgggaatgatgctgctgccgagatgaggaag-
A0A8B9P3N9_MCL1-01      gggctttgttgacttcttccgag--------------tagaggacctag-
A0A8B9PRT7_BCL2-01      ga-------tgccttcgtggagt--------------tgtacggc--aa-
A0A8B9PRT7_BCL2-02      gg-------taactccaagcagg--------------cat-cacc--gg-
                                    *  *                                  

A0A8B9S513_BCL2A1-      ttgaaaggagatcactactgtctctctccaaaatt---acagccatattc
A0A8B9NWH6_BCL2L1-      -ggccaggagaccttcaacaaatggctcctgact----ggggcgaccgtg
A0A8B9NWH6_BCL2L1-      -ggccaggagaccttcaacaaatggctcctgact----ggggcgaccgtg
A0A8B9P3N9_MCL1-01      -aaggaagca----------------tccggaatgta-ctgatggctttt
A0A8B9PRT7_BCL2-01      -cagtatgcggcctttgttcgatttctcctggatctctctgaagactatc
A0A8B9PRT7_BCL2-02      -agggacgtg------------------ctggatctc-agacagactttg
                             * *                    *    *              * 

A0A8B9S513_BCL2A1-      atagcttttttttccctg-------------ttcagagagtact------
A0A8B9NWH6_BCL2L1-      gcaggagtgcttctcctgggat---------ctctgctgagccg------
A0A8B9NWH6_BCL2L1-      gcaggagtgcttctcctgggat---------ctctgctgagccg------
A0A8B9P3N9_MCL1-01      gcaggagttgctggactgggagcaagcttggcctacatgatacg------
A0A8B9PRT7_BCL2-01      ctaagtctggttctggtg--gg--agcttgcatcactcttggcgcttatc
A0A8B9PRT7_BCL2-02      cgcagcccagc----gtggcgg--agcttgcctcac-cgagacgtt----
                                        **                        *       

A0A8B9S513_BCL2A1-      ---------actga
A0A8B9NWH6_BCL2L1-      -------caagtga
A0A8B9NWH6_BCL2L1-      -------caagtga
A0A8B9P3N9_MCL1-01      ----------gtga
A0A8B9PRT7_BCL2-01      tcggacataagtag
A0A8B9PRT7_BCL2-02      -------ggagta-

© 1998-2023Legal notice