Dataset for CDS BCL-2-like of organism Apteryx owenii

[Download (right click)] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8B9P3N9_MCL1-01        tccccgtggcttttcccacatgctcccacgtcctttggggcgggcgcgat
A0A8B9PRT7_BCL2-02        a-----tggc----------------------------------------
A0A8B9PRT7_BCL2-01        a-----tggc----------------------------------------
A0A8B9NWH6_BCL2L1-01      a-----tgtc----------------------------------------
A0A8B9S513_BCL2A1-01      a-----tgga----------------------------------------
A0A8B9NWH6_BCL2L1-02      a-----tgtc----------------------------------------
                                **                                          

A0A8B9P3N9_MCL1-01        tttgcgccagccacgtgcgggg--agggagcgaagggcggcagggcgaag
A0A8B9PRT7_BCL2-02        ------------tcatccggggagaagaggctacgataaccgggagatag
A0A8B9PRT7_BCL2-01        ------------tcatccggggagaagaggctacgataaccgggagatag
A0A8B9NWH6_BCL2L1-01      ------------------------------cagcagtaaccgggaattag
A0A8B9S513_BCL2A1-01      ------------------------------aaccgctgagtttta-----
A0A8B9NWH6_BCL2L1-02      ------------------------------cagcagtaaccgggaattag
                                                                            

A0A8B9P3N9_MCL1-01        tgcaggaggcctggcctccgctggggatcgccgtgtggatccctggaaa-
A0A8B9PRT7_BCL2-02        tgctgaag---------------------------tacatccattataa-
A0A8B9PRT7_BCL2-01        tgctgaag---------------------------tacatccattataa-
A0A8B9NWH6_BCL2L1-01      tgattgac---------------------------tttgtttcctacaa-
A0A8B9S513_BCL2A1-01      -------t---------------------------tacgtttattattta
A0A8B9NWH6_BCL2L1-02      tgattgac---------------------------tttgtttcctacaa-
                                                             *   *          

A0A8B9P3N9_MCL1-01        gtccgcagagatgggaaaccgcaagggccgttggcag-----------gg
A0A8B9PRT7_BCL2-02        actctcgcagaggggatacgactgggctg-ccagcggcgaccgggcgcca
A0A8B9PRT7_BCL2-01        actctcgcagaggggatacgactgggctg-ccagcggcgaccgggcgcca
A0A8B9NWH6_BCL2L1-01      gctctcacagaagggatacagctggagtc-agctcgaggaagaggatg--
A0A8B9S513_BCL2A1-01      gctcacga------------------------------------------
A0A8B9NWH6_BCL2L1-02      gctctcacagaagggatacagctggagtc-agctcgaggaagaggatg--
                             * *                                            

A0A8B9P3N9_MCL1-01        ggatcccaaagagaaaccccccccgctgcagctggcg-tgcggctctgct
A0A8B9PRT7_BCL2-02        gcgtctccagggctctctcctcctgctgctgctgctcttgctg-------
A0A8B9PRT7_BCL2-01        gcgtctccagggctctctcctcctgctgctgctgctcttgctg-------
A0A8B9NWH6_BCL2L1-01      ---agaacagg----------------actgattttgcggtag-------
A0A8B9S513_BCL2A1-01      --------------------------------------------------
A0A8B9NWH6_BCL2L1-02      ---agaacagg----------------actgattttgcggtag-------
                                                                            

A0A8B9P3N9_MCL1-01        cactagcaggatgctcggctcgaaggcagccggatttgggatgcgtcgag
A0A8B9PRT7_BCL2-02        --------------------------------------------------
A0A8B9PRT7_BCL2-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-01      --------------------------------------------------
A0A8B9S513_BCL2A1-01      --------------------------------------------------
A0A8B9NWH6_BCL2L1-02      --------------------------------------------------
                                                                            

A0A8B9P3N9_MCL1-01        gttagggagcagggcacgaagcacagcaggggcagaccagaacgagacgg
A0A8B9PRT7_BCL2-02        --------------------------------------------------
A0A8B9PRT7_BCL2-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-01      --------------------------------------------------
A0A8B9S513_BCL2A1-01      --------------------------------------------------
A0A8B9NWH6_BCL2L1-02      --------------------------------------------------
                                                                            

A0A8B9P3N9_MCL1-01        cgccgcgaatcccccaaaacgagccaaaccgtatcccagcgggtcggcgc
A0A8B9PRT7_BCL2-02        ---------------------------------------ctgctgggact
A0A8B9PRT7_BCL2-01        ---------------------------------------ctgctgggact
A0A8B9NWH6_BCL2L1-01      ---------------------------------------aggctgggatg
A0A8B9S513_BCL2A1-01      --------------------------------------------------
A0A8B9NWH6_BCL2L1-02      ---------------------------------------aggctgggatg
                                                                            

A0A8B9P3N9_MCL1-01        ctcccgcttttccccggaatggtatttccccacgtctacgtgatgccgct
A0A8B9PRT7_BCL2-02        tcctctgatcacactgggctggtgtctccgcacccc--------------
A0A8B9PRT7_BCL2-01        tcctctgatcacactgggctggtgtctccgcacccc--------------
A0A8B9NWH6_BCL2L1-01      gccggtgtccttaatgggagcccatcctggcaccc---------------
A0A8B9S513_BCL2A1-01      --------------ttatctgcagtatgttcttc----------------
A0A8B9NWH6_BCL2L1-02      gccggtgtccttaatgggagcccatcctggcaccc---------------
                                                  *     *                   

A0A8B9P3N9_MCL1-01        caccaggccgctcgctccggagccgatcggctcgttccgggtgcaccggg
A0A8B9PRT7_BCL2-02        -------------------gagccccccggctcggct--gctgctagtaa
A0A8B9PRT7_BCL2-01        -------------------gagccccccggctcggct--gctgctagtaa
A0A8B9NWH6_BCL2L1-01      -------------------------ccctgctagcca--catagt--gaa
A0A8B9S513_BCL2A1-01      --------------------------------------------------
A0A8B9NWH6_BCL2L1-02      -------------------------ccctgctagcca--catagt--gaa
                                                                            

A0A8B9P3N9_MCL1-01        gccgcccggcgtcgacgagctgcgccagga------------------ct
A0A8B9PRT7_BCL2-02        cgcggccccgggtgacgggctgcgcccggc------------------gc
A0A8B9PRT7_BCL2-01        cgcggccccgggtgacgggctgcgcccggc------------------gc
A0A8B9NWH6_BCL2L1-01      cggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaag
A0A8B9S513_BCL2A1-01      -------aagaatcacaccttg-gaccagc------------------cc
A0A8B9NWH6_BCL2L1-02      cggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaag
                                        **       * *  *                     

A0A8B9P3N9_MCL1-01        cgctggagctcatcggccgctacctgcgggaggcggcgggcgaagccgag
A0A8B9PRT7_BCL2-02        caccggtggt---ccacctcgccctgcgccaagccggggatgagttctcc
A0A8B9PRT7_BCL2-01        caccggtggt---ccacctcgccctgcgccaagccggggatgagttctcc
A0A8B9NWH6_BCL2L1-01      cagctgacgt---gaggcaggcactgagagaggcgggagatgaatttgag
A0A8B9S513_BCL2A1-01      aaaccagagt---tgctcacgtcctgcg--aaacattgcattttcactgc
A0A8B9NWH6_BCL2L1-02      cagctgacgt---gaggcaggcactgagagaggcgggagatgaatttgag
                                   *       *     *** *  *  *                

A0A8B9P3N9_MCL1-01        cccggcgctaagaagctcttcccggggctgctggg--cggcccgggtagg
A0A8B9PRT7_BCL2-02        cgccgctaccagagggacttcgcccaaatgtctgg--ccagctgcacctg
A0A8B9PRT7_BCL2-01        cgccgctaccagagggacttcgcccaaatgtctgg--ccagctgcacctg
A0A8B9NWH6_BCL2L1-01      ttgaggtaccggagagctttcagtgacctcacttc--ccagctccacatc
A0A8B9S513_BCL2A1-01      aagatcaaacagaggaggctctccgaccattcttggataggattgatatt
A0A8B9NWH6_BCL2L1-02      ttgaggtaccggagagctttcagtgacctcacttc--ccagctccacatc
                                     **      **                             

A0A8B9P3N9_MCL1-01        cccggcggggcgggcgacggcgtcatggagaaggcgctggagacgctgcg
A0A8B9PRT7_BCL2-02        acac--------------------------------ccttca-c--ggc-
A0A8B9PRT7_BCL2-01        acac--------------------------------ccttca-c--ggc-
A0A8B9NWH6_BCL2L1-01      accc--------------------------------ctggca-c--tgc-
A0A8B9S513_BCL2A1-01      acct--------------------------------ctgtagatgttgc-
A0A8B9NWH6_BCL2L1-02      accc--------------------------------ctggca-c--tgc-
                           *                                  *          ** 

A0A8B9P3N9_MCL1-01        gcgggtcggcaacggcgtcatgcagaagcacgagctcgccttccaaggaa
A0A8B9PRT7_BCL2-02        --------------------------------------------------
A0A8B9PRT7_BCL2-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-01      --------------------------------------------------
A0A8B9S513_BCL2A1-01      --------------------------------------------------
A0A8B9NWH6_BCL2L1-02      --------------------------------------------------
                                                                            

A0A8B9P3N9_MCL1-01        tgctgcggaagctggaaatcaagaaggaggaagacctgcagtcagtgtgt
A0A8B9PRT7_BCL2-02        ----------------------------------cagaggccgctttgtg
A0A8B9PRT7_BCL2-01        ----------------------------------cagaggccgctttgtg
A0A8B9NWH6_BCL2L1-01      ----------------------------------gtatcagagctttgag
A0A8B9S513_BCL2A1-01      ----------------------------------caagcgaattttcaat
A0A8B9NWH6_BCL2L1-02      ----------------------------------gtatcagagctttgag
                                                                       *    

A0A8B9P3N9_MCL1-01        gaggtggcagcccatgttttcagtgatggagtaacaaactggggcagagt
A0A8B9PRT7_BCL2-02        gccgtggtggaggagctcttccgagacggg---gtcaactgggggagaat
A0A8B9PRT7_BCL2-01        gccgtggtggaggagctcttccgagacggg---gtcaactgggggagaat
A0A8B9NWH6_BCL2L1-01      caggtggtgaacgaactcttccgggacgga---gtgaactggggtcgcat
A0A8B9S513_BCL2A1-01      ggagtcatggaagaaaaatttgctgatggaaatactaactggggacgaat
A0A8B9NWH6_BCL2L1-02      caggtggtgaacgaactcttccgggacgga---gtgaactggggtcgcat
                             **        *    **    ** **       ********  *  *

A0A8B9P3N9_MCL1-01        tgtgacactcatctcatttggtgcctttgttgc----------aaaacac
A0A8B9PRT7_BCL2-02        cgtggccttcttcgagttcggc----------------agcgtcatgtgc
A0A8B9PRT7_BCL2-01        cgtggccttcttcgagttcggc----------------agcgtcatgtgc
A0A8B9NWH6_BCL2L1-01      cgtggctttcttctccttcgga----------------ggggcgttgtgc
A0A8B9S513_BCL2A1-01      catgaccatatttacatttggaggacttctcactaagaagcttcaagagc
A0A8B9NWH6_BCL2L1-02      cgtggctttcttctccttcgga----------------ggggcgttgtgc
                            ** *  *  *    ** **                            *

A0A8B9P3N9_MCL1-01        ctgaaaagcataaaccaggagaagtgcat-------cagctcattagcag
A0A8B9PRT7_BCL2-02        gtggagagcgtcaaccgggagatgtcccccctggtggacagcattg-cca
A0A8B9PRT7_BCL2-01        gtggagagcgtcaaccgggagatgtcccccctggtggacagcattg-cca
A0A8B9NWH6_BCL2L1-01      gtggagagcgttgacaaggagatgcgggtattggttggacgcgttg-tat
A0A8B9S513_BCL2A1-01      atggagttcagctcacaggagagga-------gaaggagcagattt-ctt
A0A8B9NWH6_BCL2L1-02      gtggagagcgttgacaaggagatgcgggtattggttggacgcgttg-tat
                           ** *   *        ***** *                   **     

A0A8B9P3N9_MCL1-01        ggatcatcacagatgctcttgtctcatctaaacgagagtggctgatgagc
A0A8B9PRT7_BCL2-02        cctggatgaccgagtacctgaaccggcacctgcatacttggatccaggac
A0A8B9PRT7_BCL2-01        cctggatgaccgagtacctgaaccggcacctgcatacttggatccaggac
A0A8B9NWH6_BCL2L1-01      cttggatgaccacgtacttgaccgaccatctagacccctggatccaagag
A0A8B9S513_BCL2A1-01      atttcatcacagagtacatcataaacaacaaagctgaatggatagatgca
A0A8B9NWH6_BCL2L1-02      cttggatgaccacgtacttgaccgaccatctagacccctggatccaagag
                               ** **        *                   *** *       

A0A8B9P3N9_MCL1-01        caaggaggctgggagggctttgttgacttcttccgagt-----a-gagga
A0A8B9PRT7_BCL2-02        aacggcggctggcaggtaactc--------------------caagcagg
A0A8B9PRT7_BCL2-01        aacggcggctgggatgccttcgtggagttgtacggcaac-agtatgcggc
A0A8B9NWH6_BCL2L1-01      aatggcggatgggagcggtttgtggacctctacgggaatgatgctgctgc
A0A8B9S513_BCL2A1-01      aacggtggctgggaaaacggcttcc-----------------tgacaaag
A0A8B9NWH6_BCL2L1-02      aatggcggatgggagcggtttgtggacctctacgggaatgatgctgctgc
                           * ** ** *** *                                    

A0A8B9P3N9_MCL1-01        cctaga--aggaagcatccggaatg-tactgatgg--cttttgcaggagt
A0A8B9PRT7_BCL2-02        catcaccggagggacgtgctggatctcaga-caga--ctttgcgcagccc
A0A8B9PRT7_BCL2-01        ctttgt--tcgatttctcctggatctctctgaaga--ctatcctaagtct
A0A8B9NWH6_BCL2L1-01      cgagat--gaggaagggccaggagaccttcaacaaatggctcctgactgg
A0A8B9S513_BCL2A1-01      tttgaaaggagatcactactgtctctctcc-aaaa--ttac-agccat-a
A0A8B9NWH6_BCL2L1-02      cgagat--gaggaagggccaggagaccttcaacaaatggctcctgactgg
                                    *       * *                             

A0A8B9P3N9_MCL1-01        tgctggactg--ggagc-aagcttggc--------------ctacat-ga
A0A8B9PRT7_BCL2-02        ----agcgtggcggagc-ttgcctcac--------------cgagac-gt
A0A8B9PRT7_BCL2-01        ggttctggtg--ggagc-ttgcatcactcttggcgcttatctcggac-at
A0A8B9NWH6_BCL2L1-01      ggcgaccgtg--gcaggagtgcttct-cctgggatctctgctgagcc-gc
A0A8B9S513_BCL2A1-01      ----ttcatagctttt-------------ttttccctgttcagagagtac
A0A8B9NWH6_BCL2L1-02      ggcgaccgtg--gcaggagtgcttct-cctgggatctctgctgagcc-gc
                                  *                                         

A0A8B9P3N9_MCL1-01        tacggtga
A0A8B9PRT7_BCL2-02        t-ggagta
A0A8B9PRT7_BCL2-01        --aagtag
A0A8B9NWH6_BCL2L1-01      --aagtga
A0A8B9S513_BCL2A1-01      --tactga
A0A8B9NWH6_BCL2L1-02      --aagtga
                                  

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice