Dataset for CDS BCL-2-like of organism Apteryx owenii

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8B9NWH6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggctgggatggccggtgtccttaatgggagcccatcctggc
acccccctgctagccacatagtgaacggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaagcagct
gacgtgaggcaggcactgagagaggcgggagatgaatttgagttgaggtaccggagagctttcagtgacctcacttccca
gctccacatcacccctggcactgcgtatcagagctttgagcaggtggtgaacgaactcttccgggacggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgcgtggagagcgttgacaaggagatgcgggtattggttgga
cgcgttgtatcttggatgaccacgtacttgaccgaccatctagacccctggatccaagagaatggcggatgggagcggtt
tgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagaccttcaacaaatggctcctgactgggg
cgaccgtggcaggagtgcttctcctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9NWH6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggctgggatggccggtgtccttaatgggagcccatcctggc
acccccctgctagccacatagtgaacggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaagcagct
gacgtgaggcaggcactgagagaggcgggagatgaatttgagttgaggtaccggagagctttcagtgacctcacttccca
gctccacatcacccctggcactgcgtatcagagctttgagcaggtggtgaacgaactcttccgggacggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgcgtggagagcgttgacaaggagatgcgggtattggttgga
cgcgttgtatcttggatgaccacgtacttgaccgaccatctagacccctggatccaagagaatggcggatgggagcggtt
tgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagaccttcaacaaatggctcctgactgggg
cgaccgtggcaggagtgcttctcctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9P3N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Apteryx owenii GN=MCL-1 (length=1077 residues).
tccccgtggcttttcccacatgctcccacgtcctttggggcgggcgcgattttgcgccagccacgtgcggggagggagcg
aagggcggcagggcgaagtgcaggaggcctggcctccgctggggatcgccgtgtggatccctggaaagtccgcagagatg
ggaaaccgcaagggccgttggcagggggatcccaaagagaaaccccccccgctgcagctggcgtgcggctctgctcacta
gcaggatgctcggctcgaaggcagccggatttgggatgcgtcgaggttagggagcagggcacgaagcacagcaggggcag
accagaacgagacggcgccgcgaatcccccaaaacgagccaaaccgtatcccagcgggtcggcgcctcccgcttttcccc
ggaatggtatttccccacgtctacgtgatgccgctcaccaggccgctcgctccggagccgatcggctcgttccgggtgca
ccggggccgcccggcgtcgacgagctgcgccaggactcgctggagctcatcggccgctacctgcgggaggcggcgggcga
agccgagcccggcgctaagaagctcttcccggggctgctgggcggcccgggtaggcccggcggggcgggcgacggcgtca
tggagaaggcgctggagacgctgcggcgggtcggcaacggcgtcatgcagaagcacgagctcgccttccaaggaatgctg
cggaagctggaaatcaagaaggaggaagacctgcagtcagtgtgtgaggtggcagcccatgttttcagtgatggagtaac
aaactggggcagagttgtgacactcatctcatttggtgcctttgttgcaaaacacctgaaaagcataaaccaggagaagt
gcatcagctcattagcagggatcatcacagatgctcttgtctcatctaaacgagagtggctgatgagccaaggaggctgg
gagggctttgttgacttcttccgagtagaggacctagaaggaagcatccggaatgtactgatggcttttgcaggagttgc
tggactgggagcaagcttggcctacatgatacggtga
>gnl|bcl2dbcds|A0A8B9PRT7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Apteryx owenii GN=BCL-2 (length=717 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccattataaactctcgcagagggg
atacgactgggctgccagcggcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgctcttgctgctg
ctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagtaacgcggcc
ccgggtgacgggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggggatgagttctcccgccgcta
ccagagggacttcgcccaaatgtctggccagctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttcgagttcggcagcgtcatgtgcgtggagagc
gtcaaccgggagatgtcccccctggtggacagcattgccacctggatgaccgagtacctgaaccggcacctgcatacttg
gatccaggacaacggcggctgggatgccttcgtggagttgtacggcaacagtatgcggcctttgttcgatttctcctgga
tctctctgaagactatcctaagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9PRT7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Apteryx owenii GN=BCL-2 (length=684 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccattataaactctcgcagagggg
atacgactgggctgccagcggcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgctcttgctgctg
ctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagtaacgcggcc
ccgggtgacgggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggggatgagttctcccgccgcta
ccagagggacttcgcccaaatgtctggccagctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttcgagttcggcagcgtcatgtgcgtggagagc
gtcaaccgggagatgtcccccctggtggacagcattgccacctggatgaccgagtacctgaaccggcacctgcatacttg
gatccaggacaacggcggctggcaggtaactccaagcaggcatcaccggagggacgtgctggatctcagacagactttgc
gcagcccagcgtggcggagcttgcctcaccgagacgttggagta
>gnl|bcl2dbcds|A0A8B9S513_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2A1 (length=525 residues).
atggaaaccgctgagttttattacgtttattatttagctcacgattatctgcagtatgttcttcaagaatcacaccttgg
accagcccaaaccagagttgctcacgtcctgcgaaacattgcattttcactgcaagatcaaacagaggaggctctccgac
cattcttggataggattgatattacctctgtagatgttgccaagcgaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaatcatgaccatatttacatttggaggacttctcactaagaagcttcaagagcatgg
agttcagctcacaggagaggagaaggagcagatttcttatttcatcacagagtacatcataaacaacaaagctgaatgga
tagatgcaaacggtggctgggaaaacggcttcctgacaaagtttgaaaggagatcactactgtctctctccaaaattaca
gccatattcatagcttttttttccctgttcagagagtactactga
© 1998-2022Legal notice