Dataset for CDS BCL-2 of organism Crocodylus porosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7M4G2E0_BCL2-01      atggaggctgggagattatttcagccaaaaagaatacatgtaagaaccag
A0A7M4G2E0_BCL2-02      atggaggctg----------------------------------------
A0A7M4EPU7_BCL2-01      atgtcttcca----------------------------------------
A0A7M4G2E0_BCL2-03      atggctaatc----------------------------------------
                        ***                                               

A0A7M4G2E0_BCL2-01      gatgtctcaaacagacagacctcaccgagataagccataccgatactacg
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
                                                                          

A0A7M4G2E0_BCL2-01      agagccatggttatgacaggcacaacacagacagaaggactaaagaacca
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
                                                                          

A0A7M4G2E0_BCL2-01      tacccatcccacggaaggtcagcaaaagagactcacagcacccagaactc
A0A7M4G2E0_BCL2-02      ----------------ggtcagcaaaagagactcacagcacccagaactc
A0A7M4EPU7_BCL2-01      ------------------cagtgaaaacaggctatcataaccggg-----
A0A7M4G2E0_BCL2-03      ------------------ctgggagaagaggctatgataaccggg-----
                                               * ** ** **   *  ***  *     

A0A7M4G2E0_BCL2-01      cagaccttccagactttgttcagatccttataaaaaaaacgcagtatcaa
A0A7M4G2E0_BCL2-02      cagaccttccagactttgttcagatccttataaaaaaaacgcagtatcaa
A0A7M4EPU7_BCL2-01      ----------agatagtgctaaagtacatccattacaaac----tatcac
A0A7M4G2E0_BCL2-03      ----------agatagtgctgaagtacatccattacaaac----tgtcac
                                  ***   ** * *  * * *  *  * ****    * *** 

A0A7M4G2E0_BCL2-01      ctcatggctacgtcagctcttctcctcacttttatcctcccaaacagacc
A0A7M4G2E0_BCL2-02      ctcatggctacgtcagctcttctcctcacttttatcctcccaaacagacc
A0A7M4EPU7_BCL2-01      agaggggatacgactgggctgc-------------ccaccaagacag---
A0A7M4G2E0_BCL2-03      agagggggtacgactgggctgc-------------ccaccaagacag---
                             ** **** * *  ** *             ** ** * ****   

A0A7M4G2E0_BCL2-01      ttttcagagaaatgtgcaaacatatgctcaacaagaggtattttgaaatt
A0A7M4G2E0_BCL2-02      ttttcagagaaatgtgcaaacatatgctcaacaagaggtattttgaaatt
A0A7M4EPU7_BCL2-01      -----------------------------agcatggtgtcctctg-----
A0A7M4G2E0_BCL2-03      -----------------------------agcacggggtcctccg-----
                                                     * ** *  **  *  *     

A0A7M4G2E0_BCL2-01      tgttgaaattacagtcagcattctgatgctgatttgtgttgcagctgccc
A0A7M4G2E0_BCL2-02      tgttgaaattacagtcagcattctgatgctgatttgtgttgcagctgccc
A0A7M4EPU7_BCL2-01      ------------agtctctctcctgctgctgc----tgttgctgctgctg
A0A7M4G2E0_BCL2-03      ------------agtcattctcctgctgctgc----tgttgctgctgctg
                                    ****    * *** *****     ****** *****  

A0A7M4G2E0_BCL2-01      agacagccatttcaggctacacctccatcggcggcttgggaatgggctcc
A0A7M4G2E0_BCL2-02      agacagccatttcaggctacacctccatcggcggcttgggaatgggctcc
A0A7M4EPU7_BCL2-01      ggacttcc---tctgacaata-ctgggctggtgtctctgcatcgtgagcc
A0A7M4G2E0_BCL2-03      ggacttcc---tctgaccatg-ctgggccggtgtctctgcatcctgagcc
                         ***  **   ** * * *   **     ** * **  * *    *  **

A0A7M4G2E0_BCL2-01      ttc-agcctggataccgcttacagcccatttgaaggatatgaactgaa--
A0A7M4G2E0_BCL2-02      ttc-agcctggataccgcttacagcccatttgaaggatatgaactgaa--
A0A7M4EPU7_BCL2-01      tgctggctcagctgctgctagtaatgtgcctcctggtaatgacctgggcc
A0A7M4G2E0_BCL2-03      tgctggctcagctgctgctagtaatgtgcctcctggtaatgagccgggcc
                        * *  **   * * * ***   *       *   **  **** * *    

A0A7M4G2E0_BCL2-01      -------ggaggtgagagacctggacatgcagttcagccagatgagag--
A0A7M4G2E0_BCL2-02      -------ggaggtgagagacctggacatgcagttcagccagatgagag--
A0A7M4EPU7_BCL2-01      cagtcctacaggctgtccacctgaccctgc------gccaagcgggagat
A0A7M4G2E0_BCL2-03      cagccccacaggctgtccacctgaccctgc------gccaagcgggagat
                                 ***      *****  * ***      ****   * ***  

A0A7M4G2E0_BCL2-01      ----ccccttgtgtgtac---gggggcattgccttca-gcctgacaatgg
A0A7M4G2E0_BCL2-02      ----ccccttgtgtgtac---gggggcattgccttca-gcctgacaatgg
A0A7M4EPU7_BCL2-01      gatttctcctgccgctaccagagtgacgttgcccaaatgtctggcca--g
A0A7M4G2E0_BCL2-03      gatttctcccgccgctaccagagtgactttgcccaaatgtctggcca--g
                             * *  *    ***    * * * *****   * * *** * *  *

A0A7M4G2E0_BCL2-01      ctgcacttacactcct-------------gttcctcgtcgttggggcaaa
A0A7M4G2E0_BCL2-02      ctgcacttacactcct-------------gttcctcgtcgttggggcaaa
A0A7M4EPU7_BCL2-01      ctgcacttgacccccttcacagccaggaggcgttttatggcagtagtaga
A0A7M4G2E0_BCL2-03      ctgcacttgacccccttcacagccagggggcgctttgtggcggtagtgga
                        ********   * ***             *    *  * *  *  *   *

A0A7M4G2E0_BCL2-01      gcaaattcatcgtctctccatgccactgctcgtggcagaa-tgt-gcctt
A0A7M4G2E0_BCL2-02      gcaaattcatcgtctctccatgccactgctcgtggcagaa-tgt-gcctt
A0A7M4EPU7_BCL2-01      ggaact-----gttccgagatggagtgaactggggaagaattgtagcctt
A0A7M4G2E0_BCL2-03      ggagct-----gttccgagacggagtgaactgggggagaattgtggcctt
                        * *  *     **  *   * *         * ** **** *** *****

A0A7M4G2E0_BCL2-01      tgatattctggctggtatggcatacatctcagccgttggcctctacctgt
A0A7M4G2E0_BCL2-02      tgatattctggctggtatggcatacatctcagccgttggcctctacctgt
A0A7M4EPU7_BCL2-01      ctttgggttcggtggcgtgatgtgcg---------------------tgg
A0A7M4G2E0_BCL2-03      ctttgagttcggtggcgtgatgtgcg---------------------tgg
                           *    * * ***  **   * *                      ** 

A0A7M4G2E0_BCL2-01      attttgtcatccaggtga-------------acacaacagatgtatgcaa
A0A7M4G2E0_BCL2-02      attttgtcatccaggtga-------------acacaacagatgtatgcaa
A0A7M4EPU7_BCL2-01      agaatgtcaaccaggagatgtcgcccctcgtggacaacat-----tgcaa
A0A7M4G2E0_BCL2-03      agagtgtcaaccgggagatgtcgcccctcgtggacaacat-----tgcaa
                        *   ***** ** ** **               ******      *****

A0A7M4G2E0_BCL2-01      gaggagggagaggttgtatgcacgccggggatacacatcaatgaactgcg
A0A7M4G2E0_BCL2-02      gaggagggagaggttgtatgcacgccggggatacacatcaatgaactgcg
A0A7M4EPU7_BCL2-01      catggatgatggagtatctgaac-------aggcacctcca-gaactg--
A0A7M4G2E0_BCL2-03      catggatgacggagtacctgaac-------aggcacctcca-gaactg--
                         * *   **  *  *   ** **       *  *** ** * ******  

A0A7M4G2E0_BCL2-01      aggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcc
A0A7M4G2E0_BCL2-02      aggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcc
A0A7M4EPU7_BCL2-01      -gatcca---ggacaacggag-----gctg-------------ggatgcc
A0A7M4G2E0_BCL2-03      -gatcca---ggacaatggag-----gctg-------------ggatgcc
                         * * **   ** * * * **     ****             ** ****

A0A7M4G2E0_BCL2-01      tgtttgtacttcccaagctctgtcatctgcgctcgcaccattcggaccgt
A0A7M4G2E0_BCL2-02      tgtttgtacttcccaagctctgtcatctgcgctcgcaccattcggaccgt
A0A7M4EPU7_BCL2-01      ttcatagaat---------------tgtatggtaacaacatgagactgtt
A0A7M4G2E0_BCL2-03      ttcgtggaat---------------tgtatggtaacaacatgagaccatt
                        *   *  * *               * *  * *  ** ***  *     *

A0A7M4G2E0_BCL2-01      gaggaactt---ccggaggcaccagacacagcctcagtacagcccagaga
A0A7M4G2E0_BCL2-02      gaggaactt---ccggaggcaccagacacagcctcagtacagcccagaga
A0A7M4EPU7_BCL2-01      gattgacttcttctggatctcttggaaa----------actatcataagt
A0A7M4G2E0_BCL2-03      gattgacttctcctggatctcttggaaa----------actatcttaagt
                        **   ****   * ***       ** *          **   *   ** 

A0A7M4G2E0_BCL2-01      gcagctacagagagagaggccaccacaaagccaacagaagccctgaaagc
A0A7M4G2E0_BCL2-02      gcagctacagagagagaggccaccacaaagccaacagaagccctgaaagc
A0A7M4EPU7_BCL2-01      ctggttctggtgggag--------------------------cttgcatc
A0A7M4G2E0_BCL2-03      ctggttctggtgggag--------------------------cttgcatc
                           * *   * * ***                          **   * *

A0A7M4G2E0_BCL2-01      acccgcagcatgcaggcagtggcaacgttggtgtag
A0A7M4G2E0_BCL2-02      acccgcagcatgcaggcagtggcaacgttggtgtag
A0A7M4EPU7_BCL2-01      actcttggtgcttatctag----gacataagtaa--
A0A7M4G2E0_BCL2-03      actcttggcgcttatctag----gacataagtga--
                        ** *   *     *   **     ** *  **    

© 1998-2021Legal notice