Dataset for CDS BCL-2 of organism Crocodylus porosus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A7M4EPU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=711 residues).
atgtcttccacagtgaaaacaggctatcataaccgggagatagtgctaaagtacatccattacaaactatcacagagggg
atacgactgggctgcccaccaagacagagcatggtgtcctctgagtctctctcctgctgctgctgttgctgctgctggga
cttcctctgacaatactgggctggtgtctctgcatcgtgagcctgctggctcagctgctgctagtaatgtgcctcctggt
aatgacctgggcccagtcctacaggctgtccacctgaccctgcgccaagcgggagatgatttctcctgccgctaccagag
tgacgttgcccaaatgtctggccagctgcacttgacccccttcacagccaggaggcgttttatggcagtagtagaggaac
tgttccgagatggagtgaactggggaagaattgtagccttctttgggttcggtggcgtgatgtgcgtggagaatgtcaac
caggagatgtcgcccctcgtggacaacattgcaacatggatgatggagtatctgaacaggcacctccagaactggatcca
ggacaacggaggctgggatgccttcatagaattgtatggtaacaacatgagactgttgattgacttcttctggatctctt
ggaaaactatcataagtctggttctggtgggagcttgcatcactcttggtgcttatctaggacataagtaa
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=1035 residues).
atggaggctgggagattatttcagccaaaaagaatacatgtaagaaccaggatgtctcaaacagacagacctcaccgaga
taagccataccgatactacgagagccatggttatgacaggcacaacacagacagaaggactaaagaaccatacccatccc
acggaaggtcagcaaaagagactcacagcacccagaactccagaccttccagactttgttcagatccttataaaaaaaac
gcagtatcaactcatggctacgtcagctcttctcctcacttttatcctcccaaacagaccttttcagagaaatgtgcaaa
catatgctcaacaagaggtattttgaaatttgttgaaattacagtcagcattctgatgctgatttgtgttgcagctgccc
agacagccatttcaggctacacctccatcggcggcttgggaatgggctccttcagcctggataccgcttacagcccattt
gaaggatatgaactgaaggaggtgagagacctggacatgcagttcagccagatgagagccccttgtgtgtacgggggcat
tgccttcagcctgacaatggctgcacttacactcctgttcctcgtcgttggggcaaagcaaattcatcgtctctccatgc
cactgctcgtggcagaatgtgcctttgatattctggctggtatggcatacatctcagccgttggcctctacctgtatttt
gtcatccaggtgaacacaacagatgtatgcaagaggagggagaggttgtatgcacgccggggatacacatcaatgaactg
cgaggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcctgtttgtacttcccaagctctgtcatct
gcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacacagcctcagtacagcccagagagcagctacaga
gagagaggccaccacaaagccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgttggtgtag
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=879 residues).
atggaggctgggtcagcaaaagagactcacagcacccagaactccagaccttccagactttgttcagatccttataaaaa
aaacgcagtatcaactcatggctacgtcagctcttctcctcacttttatcctcccaaacagaccttttcagagaaatgtg
caaacatatgctcaacaagaggtattttgaaatttgttgaaattacagtcagcattctgatgctgatttgtgttgcagct
gcccagacagccatttcaggctacacctccatcggcggcttgggaatgggctccttcagcctggataccgcttacagccc
atttgaaggatatgaactgaaggaggtgagagacctggacatgcagttcagccagatgagagccccttgtgtgtacgggg
gcattgccttcagcctgacaatggctgcacttacactcctgttcctcgtcgttggggcaaagcaaattcatcgtctctcc
atgccactgctcgtggcagaatgtgcctttgatattctggctggtatggcatacatctcagccgttggcctctacctgta
ttttgtcatccaggtgaacacaacagatgtatgcaagaggagggagaggttgtatgcacgccggggatacacatcaatga
actgcgaggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcctgtttgtacttcccaagctctgtc
atctgcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacacagcctcagtacagcccagagagcagcta
cagagagagaggccaccacaaagccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgttggtgtag
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=711 residues).
atggctaatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
gtacgactgggctgcccaccaagacagagcacggggtcctccgagtcattctcctgctgctgctgttgctgctgctggga
cttcctctgaccatgctgggccggtgtctctgcatcctgagcctgctggctcagctgctgctagtaatgtgcctcctggt
aatgagccgggcccagccccacaggctgtccacctgaccctgcgccaagcgggagatgatttctcccgccgctaccagag
tgactttgcccaaatgtctggccagctgcacttgacccccttcacagccagggggcgctttgtggcggtagtggaggagc
tgttccgagacggagtgaactgggggagaattgtggccttctttgagttcggtggcgtgatgtgcgtggagagtgtcaac
cgggagatgtcgcccctcgtggacaacattgcaacatggatgacggagtacctgaacaggcacctccagaactggatcca
ggacaatggaggctgggatgccttcgtggaattgtatggtaacaacatgagaccattgattgacttctcctggatctctt
ggaaaactatcttaagtctggttctggtgggagcttgcatcactcttggcgcttatctaggacataagtga
© 1998-2021Legal notice