Dataset for CDS BCL-2-like of organism Gouania willdenowi

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=774 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatgggcttcctttgcccagatcttcggacaggacgcggctgccaa
ggcgaggaaagctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtct
gctacgtcaagagacgagaaccacacttatgggtcacatacctcacattgctgaacacagcgcctctgtcataccaggaa
atatttctgttggatggatgtaatataacctcctccagcatcccacattcctag
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=606 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatggagaaccacacttatgggtcacatacctcacattgctgaaca
cagcgcctctgtcataccaggaaatatttctgttggatggatgtaa
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=660 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatgggcttcctttgcccagatcttcggacaggacgcggctgccaa
ggcgaggaaagctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtct
gctacgtcaagagacggtga
>gnl|bcl2dbcds|A0A8C5G971_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=675 residues).
atgactcagaacagagaactggttgtgttctacatcacatacaaactgtctcagaggaactaccctctggaccacatagt
gctcaatgagcctccacacaggaccgctgggtcggacgcagagcccgcagaggatgagcggacggacacgcagtccaatg
gaactttgaacgcgtctccggtgcagcagcagaggttgccgtcagcgacaagcctggatgcggtgaaggaagccctccga
gacacagccaacgagtttgagctgcgctactcgctggctttcagtgacctgcacagccagctgcacatcacgccggccac
ggcctaccagagctttgagaacgtgatggacgaggtgttccgggacggcgtcaactggggtcgcattgtggggctctttg
catttggtggagcactgtgtgtagagtgtgtggagaaggagatgagtcctttggtgggcaggattgtggagtggatgacg
gtctacctggacaaccacattcagccctggatccagagccaagggggatgggaacgctttgctgaggtcttcgggcagga
tgcggtggctgagatccggcggtccgaggaatcttttaaaaagtggctgctggtggggatgacggtggtgaccggggtgg
tggtgggttcgctcttcgcacaaaaacgtctgtga
>gnl|bcl2dbcds|A0A8C5H9Y5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi GN=MCL-1 (length=984 residues).
atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagcaacacaaaatggaggcgtagaaggacgaat
caactaccagcagaaggatccgcctcgggatcaccacgccatagacacgtctctagactctctgaacggaaacattgcct
ccagtgagaccccgaaacgacccaaaaaccttagtgtggcttccaccttcgtgcctaaagctctgcgggaggacagcgag
gacatggaggacggatctctgccgtgcacaccggaggtgcattcggacactgaggccgaggtctcgaattgcagtggcgg
ggcggaggtgctggagaacgacaccaggcaactaatgtcccggttcttagccgactatacaggactttctaagcgcgatt
ggaatgaaagcaaagcactgtcgaccatgaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatgga
atggtcaacaagttatcactggataactgtagtgatgatatgacatttgtcagcgctgtggcgaagagccttttcgcaga
ccaacgcaccaactggggtcgtattgctagcctagtggcctttggggctgttgtgtgtcaacacttgaaagaacggggca
ggtcaaactgcgtggagctggtggggcaggagatttccacataccttcttaccgagcagcgagaatggctggtgaaaaac
aattcatgggatggctttgtagactttttccgagtagcagacccagagtcaacagttaggaacacacttatggcttttgc
aggattcgctggcattggggctacactagcctttctgatcaggagggcatgtgggtgcctgaagaatgagaaggcgtgta
agcgtgggaggaggagacatcaaagaaaggggaaatcggatcccctcttcagacaaagcgagccaaggggttcagagaca
aaggaaacgagatccgccatgtga
>gnl|bcl2dbcds|A0A8C5H9Y5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi GN=MCL-1 (length=846 residues).
atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagcaacacaaaatggaggcgtagaaggacgaat
caactaccagcagaaggatccgcctcgggatcaccacgccatagacacgtctctagactctctgaacggaaacattgcct
ccagtgagaccccgaaacgacccaaaaaccttagtgtggcttccaccttcgtgcctaaagctctgcgggaggacagcgag
gacatggaggacggatctctgccgtgcacaccggaggtgcattcggacactgaggccgaggtctcgaattgcagtggcgg
ggcggaggtgctggagaacgacaccaggcaactaatgtcccggttcttagccgactatacaggactttctaagcgcgatt
ggaatgaaagcaaagcactgtcgaccatgaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatgga
atggtcaacaagttatcactggataactgtagtgatgatatgacatttgtcagcgctgtggcgaagagccttttcgcaga
ccaacgcaccaactggggtcgtattgctagcctagtggcctttggggctgttgtgtgtcaacacttgaaagaacggggca
ggtcaaactgcgtggagctggtggggcaggagatttccacataccttcttaccgagcagcgagaatggctggtgaaaaac
aattcatgggatggctttgtagactttttccgagtagcagacccagagtcaacagttaggaacacacttatggcttttgc
aggattcgctggcattggggctacactagcctttctgatcaggtga
© 1998-2022Legal notice