Dataset for CDS BCL-2-like of organism Gouania willdenowi

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C5H9Y5_MCL1-01      atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagc
A0A8C5H9Y5_MCL1-02      atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagc
A0A8C5G971_BCL2L1-      atga--ctca---gaacagag--aactggttgtgt------tctacatca
A0A8C5D4L1_BCL2L1-      atgg--cgcccgtcaacagag--aacttgtgaagt------tttttttgt
A0A8C5D4L1_BCL2L1-      atgg--cgcccgtcaacagag--aacttgtgaagt------tttttttgt
A0A8C5D4L1_BCL2L1-      atgg--cgcccgtcaacagag--aacttgtgaagt------tttttttgt
                        ***     *      **  **  **** **    *        *      

A0A8C5H9Y5_MCL1-01      aacacaaaatggaggcgtagaaggacgaatcaactaccagcagaaggatc
A0A8C5H9Y5_MCL1-02      aacacaaaatggaggcgtagaaggacgaatcaactaccagcagaaggatc
A0A8C5G971_BCL2L1-      catacaaactgt---------------------ct-----cagaggaact
A0A8C5D4L1_BCL2L1-      gccaccgactgg---------------------ct-----cagagggact
A0A8C5D4L1_BCL2L1-      gccaccgactgg---------------------ct-----cagagggact
A0A8C5D4L1_BCL2L1-      gccaccgactgg---------------------ct-----cagagggact
                           **  * **                      **     **** * *  

A0A8C5H9Y5_MCL1-01      cgcctcgggatcaccacgccatagacacgtctctagactctctgaacgga
A0A8C5H9Y5_MCL1-02      cgcctcgggatcaccacgccatagacacgtctctagactctctgaacgga
A0A8C5G971_BCL2L1-      accctctggacc--------------------------------------
A0A8C5D4L1_BCL2L1-      ttc-------cc--------------------------------------
A0A8C5D4L1_BCL2L1-      ttc-------cc--------------------------------------
A0A8C5D4L1_BCL2L1-      ttc-------cc--------------------------------------
                          *        *                                      

A0A8C5H9Y5_MCL1-01      aacattgcctccagtgagaccccgaaacgacccaaaaaccttagtgtggc
A0A8C5H9Y5_MCL1-02      aacattgcctccagtgagaccccgaaacgacccaaaaaccttagtgtggc
A0A8C5G971_BCL2L1-      -acatagtgctcaatgagcctccaca------------------------
A0A8C5D4L1_BCL2L1-      -acatc---cccgctgaggct----g------------------------
A0A8C5D4L1_BCL2L1-      -acatc---cccgctgaggct----g------------------------
A0A8C5D4L1_BCL2L1-      -acatc---cccgctgaggct----g------------------------
                         ****      *  **** *                              

A0A8C5H9Y5_MCL1-01      ttccaccttcgtgcctaaagctctgcgggaggacagcgaggacatggagg
A0A8C5H9Y5_MCL1-02      ttccaccttcgtgcctaaagctctgcgggaggacagcgaggacatggagg
A0A8C5G971_BCL2L1-      --------------caggaccgctgggtc-ggacgcagagcccgcagagg
A0A8C5D4L1_BCL2L1-      --------------caggataccagggacaggacggtg-----gtggaga
A0A8C5D4L1_BCL2L1-      --------------caggataccagggacaggacggtg-----gtggaga
A0A8C5D4L1_BCL2L1-      --------------caggataccagggacaggacggtg-----gtggaga
                                      *   *   * * *   ****   *        *** 

A0A8C5H9Y5_MCL1-01      acggat---------ctctgcc---gtgcacaccggaggtgcattcggac
A0A8C5H9Y5_MCL1-02      acggat---------ctctgcc---gtgcacaccggaggtgcattcggac
A0A8C5G971_BCL2L1-      atgagcggacggacacgcagtccaatggaactttgaacgcgtctccggt-
A0A8C5D4L1_BCL2L1-      aggaaaaggc-------cagcccgactg--ccggtaacg-gcctccagg-
A0A8C5D4L1_BCL2L1-      aggaaaaggc-------cagcccgactg--ccggtaacg-gcctccagg-
A0A8C5D4L1_BCL2L1-      aggaaaaggc-------cagcccgactg--ccggtaacg-gcctccagg-
                        * *              * * *     *  *     * * *  * * *  

A0A8C5H9Y5_MCL1-01      actgaggccgagg---------tctcgaattgcagtggcggggcggaggt
A0A8C5H9Y5_MCL1-02      actgaggccgagg---------tctcgaattgcagtggcggggcggaggt
A0A8C5G971_BCL2L1-      gcagcagcagagg---------ttgccgtcagcgacaa--gcctggatgc
A0A8C5D4L1_BCL2L1-      acagagacggggtgatcccacctcgcca-cggcgatgacgacgtggaggc
A0A8C5D4L1_BCL2L1-      acagagacggggtgatcccacctcgcca-cggcgatgacgacgtggaggc
A0A8C5D4L1_BCL2L1-      acagagacggggtgatcccacctcgcca-cggcgatgacgacgtggaggc
                         * *   * * *          *  *     **           *** * 

A0A8C5H9Y5_MCL1-01      gctggagaacgacaccaggcaactaatgtcccggttcttagccgactata
A0A8C5H9Y5_MCL1-02      gctggagaacgacaccaggcaactaatgtcccggttcttagccgactata
A0A8C5G971_BCL2L1-      ggtgaag---------------gaagccctccgagacacagccaacgagt
A0A8C5D4L1_BCL2L1-      ggtgaag---------------ttggcgctcgtggagtcagccgacgagt
A0A8C5D4L1_BCL2L1-      ggtgaag---------------ttggcgctcgtggagtcagccgacgagt
A0A8C5D4L1_BCL2L1-      ggtgaag---------------ttggcgctcgtggagtcagccgacgagt
                        * ** **                       *        **** ** *  

A0A8C5H9Y5_MCL1-01      caggact-ttctaagcgcgattggaatgaaagcaaagcactgtcgaccat
A0A8C5H9Y5_MCL1-02      caggact-ttctaagcgcgattggaatgaaagcaaagcactgtcgaccat
A0A8C5G971_BCL2L1-      ttgagctgcgctactcgctg------------------------------
A0A8C5D4L1_BCL2L1-      ttgaactcctcttcacgcaa------------------------------
A0A8C5D4L1_BCL2L1-      ttgaactcctcttcacgcaa------------------------------
A0A8C5D4L1_BCL2L1-      ttgaactcctcttcacgcaa------------------------------
                          *  **   **   ***                                

A0A8C5H9Y5_MCL1-01      gaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatg
A0A8C5H9Y5_MCL1-02      gaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatg
A0A8C5G971_BCL2L1-      ----------------------------------------gctttcagtg
A0A8C5D4L1_BCL2L1-      ----------------------------------------gcgtttaacg
A0A8C5D4L1_BCL2L1-      ----------------------------------------gcgtttaacg
A0A8C5D4L1_BCL2L1-      ----------------------------------------gcgtttaacg
                                                                ** *  *  *

A0A8C5H9Y5_MCL1-01      gaatggtcaacaagtt----atcac--------tggataactgtagtgat
A0A8C5H9Y5_MCL1-02      gaatggtcaacaagtt----atcac--------tggataactgtagtgat
A0A8C5G971_BCL2L1-      acctgcacagccagctgcacatcacgccggccacggcctaccagagc---
A0A8C5D4L1_BCL2L1-      acctggccacgcagctgcagatcacccccgacacggcctacagcagc---
A0A8C5D4L1_BCL2L1-      acctggccacgcagctgcagatcacccccgacacggcctacagcagc---
A0A8C5D4L1_BCL2L1-      acctggccacgcagctgcagatcacccccgacacggcctacagcagc---
                           **  **   ** *    *****         **   **   **    

A0A8C5H9Y5_MCL1-01      gatatgacatttgtcagcgctgtgg-cgaagagccttttcgcagaccaac
A0A8C5H9Y5_MCL1-02      gatatgacatttgtcagcgctgtgg-cgaagagccttttcgcagaccaac
A0A8C5G971_BCL2L1-      ---------tttgagaacgtgatggacgagg----tgttccgggac---g
A0A8C5D4L1_BCL2L1-      ---------ttcaaaagcgtcatggacgagg----tgttcaaggac---g
A0A8C5D4L1_BCL2L1-      ---------ttcaaaagcgtcatggacgagg----tgttcaaggac---g
A0A8C5D4L1_BCL2L1-      ---------ttcaaaagcgtcatggacgagg----tgttcaaggac---g
                                 **    * **   *** *** *    * ***   ***    

A0A8C5H9Y5_MCL1-01      gcaccaactggggtcgtattgctagcctagtggcctttggggctg--ttg
A0A8C5H9Y5_MCL1-02      gcaccaactggggtcgtattgctagcctagtggcctttggggctg--ttg
A0A8C5G971_BCL2L1-      gcgtcaactggggtcgcattgtggggctctttgcatttggtggagcactg
A0A8C5D4L1_BCL2L1-      gcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgttg
A0A8C5D4L1_BCL2L1-      gcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgttg
A0A8C5D4L1_BCL2L1-      gcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgttg
                        **  ********* ** ** *   * **  * *  ** ** *  *   **

A0A8C5H9Y5_MCL1-01      tgtgtcaacacttgaaagaacggggcaggtcaaactgcgtggagctggtg
A0A8C5H9Y5_MCL1-02      tgtgtcaacacttgaaagaacggggcaggtcaaactgcgtggagctggtg
A0A8C5G971_BCL2L1-      tgtgtagagtgtgtggagaaggagatgagtc-ctttg-gtgggcaggatt
A0A8C5D4L1_BCL2L1-      tgcttggagtgttcagagaaggacatgagcg-agctg-gtgccccgcatt
A0A8C5D4L1_BCL2L1-      tgcttggagtgttcagagaaggacatgagcg-agctg-gtgccccgcatt
A0A8C5D4L1_BCL2L1-      tgcttggagtgttcagagaaggacatgagcg-agctg-gtgccccgcatt
                        **  *  *   *    **** *      *      ** ***       * 

A0A8C5H9Y5_MCL1-01      gggcaggagatttccacataccttcttaccgagcagcgagaatggctggt
A0A8C5H9Y5_MCL1-02      gggcaggagatttccacataccttcttaccgagcagcgagaatggctggt
A0A8C5G971_BCL2L1-      gtggagtggatgacggtctacct-------ggacaaccacattcagccct
A0A8C5D4L1_BCL2L1-      gcagactggatgaccatgtacct-------ggatgagaacatcaacgagt
A0A8C5D4L1_BCL2L1-      gcagactggatgaccatgtacct-------ggatgagaacatcaacgagt
A0A8C5D4L1_BCL2L1-      gcagactggatgaccatgtacct-------ggatgagaacatcaacgagt
                        *   *   ***  *    *****       *       * *        *

A0A8C5H9Y5_MCL1-01      gaaaaacaattca----------tgggatggctttgtagactttttccga
A0A8C5H9Y5_MCL1-02      gaaaaacaattca----------tgggatggctttgtagactttttccga
A0A8C5G971_BCL2L1-      ggatccagagcca---agggggatgggaacgctttgctgaggtctt-cgg
A0A8C5D4L1_BCL2L1-      ggatagagagcgaaggaggaggatg-------------------------
A0A8C5D4L1_BCL2L1-      ggatagagagcgaaggaggaggatgggcttcctttgcccagatctt-cgg
A0A8C5D4L1_BCL2L1-      ggatagagagcgaaggaggaggatgggcttcctttgcccagatctt-cgg
                        * *     *   *          **                         

A0A8C5H9Y5_MCL1-01      gtagca------gacccagagtcaacagttaggaacacactt------at
A0A8C5H9Y5_MCL1-02      gtagca------gacccagagtcaacagttaggaacacactt------at
A0A8C5G971_BCL2L1-      gcaggatgcggtggctgagatccggcggtccgaggaatcttttaaaaagt
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      acaggacgcggctgccaaggcgaggaaagctcggaccagtatgaaacggt
A0A8C5D4L1_BCL2L1-      acaggacgcggctgccaaggcgaggaaagctcggaccagtatgaaacggt

A0A8C5H9Y5_MCL1-01      ggcttttgcaggattcgctggc----attggggctacactagcctttctg
A0A8C5H9Y5_MCL1-02      ggcttttgcaggattcgctggc----attggggctacactagcctttctg
A0A8C5G971_BCL2L1-      ggctgctggtggggatgacggtggtgaccggggtggtggtgggttcgctc
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      ggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtctgc
A0A8C5D4L1_BCL2L1-      ggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtctgc

A0A8C5H9Y5_MCL1-01      atcaggagggcatgtgggtgcctgaagaatgagaaggcgtgtaagcgtgg
A0A8C5H9Y5_MCL1-02      atcag---------------------------------------------
A0A8C5G971_BCL2L1-      ttcgcacaaaaacg------------------------------------
A0A8C5D4L1_BCL2L1-      -------------g------------------------------------
A0A8C5D4L1_BCL2L1-      tacgtcaagagacg------------------------------------
A0A8C5D4L1_BCL2L1-      tacgtcaagagacg------------------------------------

A0A8C5H9Y5_MCL1-01      gaggaggagacatcaaagaaaggggaaatcggatcccctcttcagacaaa
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      ----------------agaaccacacttatgggtcacatacctcacattg
A0A8C5D4L1_BCL2L1-      ----------------agaaccacacttatgggtcacatacctcacattg
A0A8C5D4L1_BCL2L1-      ----------------gtga------------------------------

A0A8C5H9Y5_MCL1-01      gcgagccaaggggttcagagacaaaggaaacgagatccgccatgtga---
A0A8C5H9Y5_MCL1-02      -------------------------------------------gtga---
A0A8C5G971_BCL2L1-      --------------tctgtga-----------------------------
A0A8C5D4L1_BCL2L1-      ctgaacacagcgcctctgtcataccaggaaatatttctgttggatggatg
A0A8C5D4L1_BCL2L1-      ctgaacacagcgcctctgtcataccaggaaatatttctgttggatggatg
A0A8C5D4L1_BCL2L1-      --------------------------------------------------

A0A8C5H9Y5_MCL1-01      ----------------------------------
A0A8C5H9Y5_MCL1-02      ----------------------------------
A0A8C5G971_BCL2L1-      ----------------------------------
A0A8C5D4L1_BCL2L1-      taa-------------------------------
A0A8C5D4L1_BCL2L1-      taatataacctcctccagcatcccacattcctag
A0A8C5D4L1_BCL2L1-      ----------------------------------

© 1998-2023Legal notice