Dataset for CDS BAK1 of organism Balaenoptera musculus

[Download (right click)] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8C0D3A6_BAK1-01      atggcatccggacaaggcccaggtcctcccagacaggggtgcgaagaacc
A0A8C0D3A6_BAK1-02      atggcatccggacaaggcccaggtcctcccagacaggggtgcgaagaacc
                        **************************************************

A0A8C0D3A6_BAK1-01      tgacccctcctccacttcggaggagcaggtagcccgggacacggaggagg
A0A8C0D3A6_BAK1-02      tgacccctcctccacttcggaggagcaggtagcccgggacacggaggagg
                        **************************************************

A0A8C0D3A6_BAK1-01      ttttccgcagctacgtcttttaccgccatcagcaggagcaggaggccgag
A0A8C0D3A6_BAK1-02      ttttccgcagctacgtcttttaccgccatcagcaggagcaggaggccgag
                        **************************************************

A0A8C0D3A6_BAK1-01      ggggcggccgcgcccacagacccagaaatggtcaccttgtccctagaacc
A0A8C0D3A6_BAK1-02      ggggcggccgcgcccacagacccagaaatggtcaccttgtccctagaacc
                        **************************************************

A0A8C0D3A6_BAK1-01      tagcagcaccatggggcaggtgggtcgccagctggccatcatcggggatg
A0A8C0D3A6_BAK1-02      tagcagcaccatggggcaggtgggtcgccagctggccatcatcggggatg
                        **************************************************

A0A8C0D3A6_BAK1-01      acatcaaccggcgctacgactccgagttccaggccatgttgcagcacctg
A0A8C0D3A6_BAK1-02      acatcaaccggcgctacgactccgagttccaggccatgttgcagcacctg
                        **************************************************

A0A8C0D3A6_BAK1-01      cagccaacagcagagaacgcctacgagtatttcaccaagattgcctcaa-
A0A8C0D3A6_BAK1-02      cagccaacagcagagaacgcctacgagtatttcaccaagattgcctcaag
                        ************************************************* 

A0A8C0D3A6_BAK1-01      -------------------gcctgtttgagagcggcatcaactggggccg
A0A8C0D3A6_BAK1-02      gccagcagcaatgcccacagcctgtttgagagcggcatcaactggggccg
                                           *******************************

A0A8C0D3A6_BAK1-01      agtggtggctctgctgggctttggctaccgcctggccctccacgtctacc
A0A8C0D3A6_BAK1-02      agtggtggctctgctgggctttggctaccgcctggccctccacgtctacc
                        **************************************************

A0A8C0D3A6_BAK1-01      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggccgac
A0A8C0D3A6_BAK1-02      agcacggcctg---------------------------------------
                        ***********                                       

A0A8C0D3A6_BAK1-01      ttcatgttgcatcactgcattgcccggtggatcgcacagagaggtggctg
A0A8C0D3A6_BAK1-02      --------------------------------------------------
                                                                          

A0A8C0D3A6_BAK1-01      ggtggcagccctggacttgggaaacggccccatctggaatgtgctgatag
A0A8C0D3A6_BAK1-02      --------------------------------------------------
                                                                          

A0A8C0D3A6_BAK1-01      ttctggctgtggttttgttgggccagtttgtggtacgaagatttttcaag
A0A8C0D3A6_BAK1-02      --------------------------------------------------
                                                                          

A0A8C0D3A6_BAK1-01      tcatga
A0A8C0D3A6_BAK1-02      -----a
                             *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice