Dataset for CDS BCL-2 of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5KV00_BCL2-01      ---atggcaaacg---------acgacaaccgctttatagtggaaaagta
A0A4W5NW18_BCL2-01      atgatggcaaacgagaatccttatgacagtcgctttattgtcgaaaaata
                           **********         * ****  ******** ** ***** **

A0A4W5KV00_BCL2-01      catttgtcacaaactcttgaaacgaggatatgcgtgggatttcgaggatg
A0A4W5NW18_BCL2-01      catccatcacaaactgttgaaaatgggatttgtatggaaatt--------
                        ***   ********* ******   **** **  *** * **        

A0A4W5KV00_BCL2-01      ctgaggaggaggaaggtgctgctaataatga-gttgatgatttctc----
A0A4W5NW18_BCL2-01      -tcaagcagaaaacgattatccaaataatggctttggggacccctctgca
                         * * *  **  * * *  * * *******   ***  **   ***    

A0A4W5KV00_BCL2-01      -------ctcgcccgggtttggcacggcggtgccacggggccaataacgc
A0A4W5NW18_BCL2-01      ccgaacacccgcgaagtttttgcacggaggtccca---gcccaccgccgc
                               * ***   * *** ****** *** ***   * ***    ***

A0A4W5KV00_BCL2-01      cggaccgggcagcgttcctcgtctttccaaa--tggctctcccaaccgga
A0A4W5NW18_BCL2-01      gggcgaggacaccgactctc--cttaccaaaacaggagtccgcaacctga
                         **   ** ** **   ***  *** *****   **    * ***** **

A0A4W5KV00_BCL2-01      cccacatgcagcaattcacagagttttgcgtgaggccggggacgaactcg
A0A4W5NW18_BCL2-01      cccacatgccaggctcaacagggtcctgcgcgaggcgggtgacgagattg
                        *********     *  **** **  **** ***** ** *****  * *

A0A4W5KV00_BCL2-01      aaagactgtaccagccagacttcgcagagatgtcacaccagctgtatctc
A0A4W5NW18_BCL2-01      gaagaatttatcacccggactttgcagagatgtcggggcagttgcatttt
                         **** * ** ** ** ***** ***********    *** ** ** * 

A0A4W5KV00_BCL2-01      acatcctccacggctgagaggagatttagagaggtgatagacgagctgtt
A0A4W5NW18_BCL2-01      acgcccaacacggcacagagaaggtttacggctgtaatagatgagctctt
                        **  **  ******  **** ** ****  *  ** ***** ***** **

A0A4W5KV00_BCL2-01      cagggatggggttaactggggacggattatcgccttcttcgagttcgggg
A0A4W5NW18_BCL2-01      cagcgacggggtaaactggggtcggattgtggctttctttgagtttggag
                        *** ** ***** ******** ****** * ** ***** ***** ** *

A0A4W5KV00_BCL2-01      gcacaatatgcgtggaatgcgtgaacaaggagatgacctcgcaagtggat
A0A4W5NW18_BCL2-01      ggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtagac
                        * ***** ********  **** ***  ********* ** ** ** ** 

A0A4W5KV00_BCL2-01      cacatcgcggtgtggatgacagagtatctaaatggaccactgctcaactg
A0A4W5NW18_BCL2-01      aacatcgcccgttggatgacggagtacttgaacggacccctacagaactg
                         *******    ******** *****  * ** ***** ** *  *****

A0A4W5KV00_BCL2-01      gattcaggagaacgggggatgggaagcctttgttgagctctatgacagac
A0A4W5NW18_BCL2-01      gatccaggagaatggtggctgggacgcctttgtggagatctatgagcagc
                        *** ******** ** ** ***** ******** *** *******    *

A0A4W5KV00_BCL2-01      agagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggc
A0A4W5NW18_BCL2-01      agaggatctc------tcactcctggccgtacctaaagacagtgttcggc
                        *****  ***          ** ******* * * ***** ** ******

A0A4W5KV00_BCL2-01      ctggctgcactgggggccgcaagccttaccattggagcataccttacaca
A0A4W5NW18_BCL2-01      ctggccgccctgggagccgccggagtcaccattggagccttgttcaccca
                        ***** ** ***** *****  *  * *********** *   * ** **

A0A4W5KV00_BCL2-01      gaagtga
A0A4W5NW18_BCL2-01      gaagtga

© 1998-2022Legal notice