Dataset for CDS BCL-2 of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4W5KV00_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgctgaggaggaggaaggtgctgctaataatgagttgatgatttctcctcgcccgggtttggcacggcggtgcc
acggggccaataacgccggaccgggcagcgttcctcgtctttccaaatggctctcccaaccggacccacatgcagcaatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagccagacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacctcgcaagtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaagcctttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccattggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A4W5NW18_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaaatgggatt
tgtatggaaatttcaagcagaaaacgattatccaaataatggctttggggacccctctgcaccgaacacccgcgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctcaacagggtcctgcgcgaggcgggtgacgagattggaagaatttatcacccggactttgcagagatgtc
ggggcagttgcattttacgcccaacacggcacagagaaggtttacggctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgcccgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccattggagccttgttcacccagaagtga
© 1998-2020Legal notice