Dataset for CDS BAX of Organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5D846_BAX-04      atggacgggtccggggagcagcccagaggcgaggggcccaccagctctga
A0A2K5D846_BAX-02      atggacgggtccggggagcagcccagaggcgaggg------------tga
A0A2K5D846_BAX-01      atggacgggtccggggagcagcccagaggcgaggggcccaccagctctga
A0A2K5D846_BAX-03      atggacgggtccggggagcagcccagaggcgaggggcccaccagctctga
                       ***********************************            ***

A0A2K5D846_BAX-04      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5D846_BAX-02      g-----------------------------------tttcatccaggatc
A0A2K5D846_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5D846_BAX-03      gcagatcatgaagacaggggcccttttgcttcagg---------------

A0A2K5D846_BAX-04      gagcagggcgaatcgggggggagacacccgagctggccctggacccggtg
A0A2K5D846_BAX-02      gagcag----------------gacacccgagctggccctggacccggtg
A0A2K5D846_BAX-01      gagcagggcgaatcgggggggagacacccgagctggccctggacccggtg
A0A2K5D846_BAX-03      --------------------------------------------------

A0A2K5D846_BAX-04      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2K5D846_BAX-02      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2K5D846_BAX-01      ccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A2K5D846_BAX-03      --------------------------------------------------

A0A2K5D846_BAX-04      ggacgagctggacagtaacatggagctgcagaggatgattgccgctgtgg
A0A2K5D846_BAX-02      ggacgagctggacagtaacatggagctgcagaggatgattgccgctgtgg
A0A2K5D846_BAX-01      ggacgagctggacagtaacatggagctgcagaggatgattgccgctgtgg
A0A2K5D846_BAX-03      --------------------------------ggatgattgccgctgtgg

A0A2K5D846_BAX-04      acacagactccccccgagaggtcttttttcgagtggcagctgacatgttc
A0A2K5D846_BAX-02      acacagactccccccgagaggtcttttttcgagtggcagctgacatgttc
A0A2K5D846_BAX-01      acacagactccccccgagaggtcttttttcgagtggcagctgacatgttc
A0A2K5D846_BAX-03      acacagactccccccgagaggtcttttttcgagtggcagctgacatgttc

A0A2K5D846_BAX-04      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2K5D846_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2K5D846_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc
A0A2K5D846_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgc

A0A2K5D846_BAX-04      cagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
A0A2K5D846_BAX-02      cagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
A0A2K5D846_BAX-01      cagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca
A0A2K5D846_BAX-03      cagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatca

A0A2K5D846_BAX-04      gaaccatcatgggctggactttggacttccttcgggagcggctgttgggc
A0A2K5D846_BAX-02      gaaccatcatgggctggactttggacttccttcgggagcggctgttgggc
A0A2K5D846_BAX-01      gaaccatcatgggctggactttggacttccttcgggagcggctgttgggc
A0A2K5D846_BAX-03      gaaccatcatgggctggactttggacttccttcgggagcggctgttgggc

A0A2K5D846_BAX-04      tggatccaagaccagggtggttgggtcacactgcttcccctgcc-catct
A0A2K5D846_BAX-02      tggatccaagaccagggtggttggg----atggcctcctctcctacttct
A0A2K5D846_BAX-01      tggatccaagaccagggtggttggg----atggcctcctctcctacttct
A0A2K5D846_BAX-03      tggatccaagaccagggtggttggg----atggcctcctctcctacttct
                       *************************    *  ** *** ** *  * ***

A0A2K5D846_BAX-04      tcagatcat--------cagat----------------------gtggtc
A0A2K5D846_BAX-02      ttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctc
A0A2K5D846_BAX-01      ttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctc
A0A2K5D846_BAX-03      ttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctc
                       *  *  **         ****                       *** **

A0A2K5D846_BAX-04      tctaatgcattt------------------------
A0A2K5D846_BAX-02      actgcctcgcttaccatctggaagaacatgggctga
A0A2K5D846_BAX-01      actgcctcgcttaccatctggaagaacatgggctga
A0A2K5D846_BAX-03      actgcctcgcttaccatctggaagaacatgggctga
                        **    *  **                        

© 1998-2023Legal notice