Dataset for CDS Unclassified of organism Amazona collaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9FCV2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amazona collaria (length=363 residues).
atgtccggccagctgcacctgacgcccttcacggccaggggccgctttgtggcagtggtggaggagctcttccgagacgg
ggttaactggggcaggatcgtggccttcttcgagtttggcggcgtcatgtgcgtggagagcgtcaaccgggagatgtcta
cccttgtaggcagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggc
tgggtatgtccgccaattgcttgttcttgttcccggctcaggcctgtggccgctgtgtccatgggattgttctggaaaac
ggcatttgttgtgatccgatgggtgactgtgtttctggggtag
© 1998-2022Legal notice