Dataset for CDS BCL-2-like of organism Anser brachyrhynchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9CVY0_BCL2A1-      atg-------------------------gaaactg---------------
A0A8B9C4H4_BCL2-01      atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaa
A0A8B9BNC2_MCL1-01      atga--aaataagggggggga----aaaaaaaaagaggcaagatagggga
A0A8B9CUX0_BCL2L1-      atg------tccgg------------cagcaaccgggacctggtgattga
                        ***                           **  *               

A0A8B9CVY0_BCL2A1-      ------ctgagttctattac----------------gtttattatt----
A0A8B9C4H4_BCL2-01      ------gtacatccac-tataaactctcg-cagaggggatacgact-ggg
A0A8B9BNC2_MCL1-01      aaaatgcaaagcccccgtgcggggtggggacggggggggcacagct-ccg
A0A8B9CUX0_BCL2L1-      ------ctttgtttcc-tacaagctgtcg-cagaagggctacagctggag
                                         *                  *   *    *    

A0A8B9CVY0_BCL2A1-      ----------------------------------------------tagc
A0A8B9C4H4_BCL2-01      ctgcc-------------------ggcgagga--------------cagg
A0A8B9BNC2_MCL1-01      ccaccgcgacttcccccagcgcggggggaggaagcgaccgtgacgacaga
A0A8B9CUX0_BCL2L1-      cca-----------------gctggaggagga---------------gga

A0A8B9CVY0_BCL2A1-      tcaagattatctgcagtatgtgcttc------------------------
A0A8B9C4H4_BCL2-01      gcgcccgcgcctacggctctcgctcc----tgctgctgctgcggttgctg
A0A8B9BNC2_MCL1-01      gggtgagaagcagcaagagcagctccgggacgcgactgcggcgtggagcg
A0A8B9CUX0_BCL2L1-      ggatgagaa----caggactgacttc-----------gcggcggaggccg
                                     *        ** *                        

A0A8B9CVY0_BCL2A1-      ------------------aggaatcacatctcggaccagcccaaaccaga
A0A8B9C4H4_BCL2-01      -------------ctgctgggactccctcccgccaccgccctgccgggct
A0A8B9BNC2_MCL1-01      gggtcacgtacccctgtgggggtgccca---ggggctttttttttggggg
A0A8B9CUX0_BCL2L1-      a---cacggac-------ggggtgctcaacgggagcccgtcct-------
                                           **   * *        *              

A0A8B9CVY0_BCL2A1-      gttgctcatgtc-------ttgcgaaacat----------tgcatcttcg
A0A8B9C4H4_BCL2-01      gctgtccccgca-------ccccgagccc-----------cccggctcgg
A0A8B9BNC2_MCL1-01      gggggctccgatggggttgctttgaggcaggaggggctgaggcagctgag
A0A8B9CUX0_BCL2L1-      ---ggcacccgc-------ccgccagccaggtagtg----aacggcgccg
                           *                    *  *              *  *   *

A0A8B9CVY0_BCL2A1-      ctgcaagatcaaacag----------aggaggctctcagacccttc----
A0A8B9C4H4_BCL2-01      ctgc-tgctagcgaggcgcccccgggcgaggggctgcg----ccccgcgc
A0A8B9BNC2_MCL1-01      ctgcgtgccggagggg-----gcgggtgaaaacccgggggggcttcaggt
A0A8B9CUX0_BCL2L1-      ccgtgcaccggagcag-----cc---tggaggtccacgaaatcgttcggt
                        * *            *           *              *       

A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9C4H4_BCL2-01      cccccg--------------------------------------------
A0A8B9BNC2_MCL1-01      tggccgagcaacgtttgcccgttgttcatccccttcctttgtgggggggg
A0A8B9CUX0_BCL2L1-      cggccg------------ccg-----------------------------

A0A8B9CVY0_BCL2A1-      --------------------------------------------ctggac
A0A8B9C4H4_BCL2-01      ----tggtccacct----------------tgccctgcgccaggccgggg
A0A8B9BNC2_MCL1-01      ggtctgaagcacccccgtacccccccatagggtgctgggggccattaggg
A0A8B9CUX0_BCL2L1-      ----tgaggca-------------------ggcgctgcgagaagccgggg

A0A8B9CVY0_BCL2A1-      aggatt--------------------------------------------
A0A8B9C4H4_BCL2-01      acgagt-----------------tctcccgccgctaccagc---------
A0A8B9BNC2_MCL1-01      acccgcggacccatccccttgtgccgagccgcgccagcaccacaacattt
A0A8B9CUX0_BCL2L1-      acgagt-----------------tcgagctgcggtaccgcc---------

A0A8B9CVY0_BCL2A1-      ------------------gatattacttctgtagatgttgcca-------
A0A8B9C4H4_BCL2-01      ------------------gggacttcgcccagatgtccggcca-------
A0A8B9BNC2_MCL1-01      ctcagctgagcagcccggggggcttcctcctcctctgtccccaccggcgg
A0A8B9CUX0_BCL2L1-      ------------------gggccttcagcgacctcacctccca-------
                                          *    * *  *           ***       

A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      gtggtgacggggggaagagctggaatttatttacttatttatttttgcct
A0A8B9CUX0_BCL2L1-      --------------------------------------------------

A0A8B9CVY0_BCL2A1-      --------------------------------------------agagaa
A0A8B9C4H4_BCL2-01      -----gctgcacctgacgcctttcac--ggccagaggcc-----------
A0A8B9BNC2_MCL1-01      ggggttttgctccgtgcgcctgtctctgagccagcgtctcttgcaggaat
A0A8B9CUX0_BCL2L1-      --------gctccaca---tcacccccggcacggcgtacc-------aga

A0A8B9CVY0_BCL2A1-      ttttcaatggt---------------------------------------
A0A8B9C4H4_BCL2-01      gcttcgtggcc---------------------------------------
A0A8B9BNC2_MCL1-01      gcttcgcaagctagaaatcaagaaggaggaagacctgcagtcggtgggcg
A0A8B9CUX0_BCL2L1-      gcttcg--agc---------------------------------------

A0A8B9CVY0_BCL2A1-      --gtcatggatgagaaatttgctgatggaaatactaattggggaagaatt
A0A8B9C4H4_BCL2-01      --gtggtggaggagctcttccgagacggggt---gaactggggccggatc
A0A8B9BNC2_MCL1-01      aggtggcggcccacgtcttcagcgacggagtgacgaactgggggcgagtc
A0A8B9CUX0_BCL2L1-      aggtggtgaacgaactcttccgcgacggagt---gaactgggggcgcgtc
                          **   *    *    **    ** **       ** *****  *  * 

A0A8B9CVY0_BCL2A1-      atgaccatatttacttttgggggtcttctcactaagaagcttcaagaaca
A0A8B9C4H4_BCL2-01      gtggccttcttcgagttcggcg------gcgtgatg-tgcgtcgagagcg
A0A8B9BNC2_MCL1-01      gtcacactcatctccttcggtgcctttgtcgccaag-cacctgaagagca
A0A8B9CUX0_BCL2L1-      gtggctttcttctccttcggag----gggcgctgtg-cg--tggagagcg
                         *  *  *  *    ** ** *       *     *     *  *** * 

A0A8B9CVY0_BCL2A1-      tggagttcagctcactggagagga-------gaaggagcagatctcttat
A0A8B9C4H4_BCL2-01      tcaac---------cgggagatgtctcccctggtggacagcatcg-----
A0A8B9BNC2_MCL1-01      taaag---------caggaga---------------agtgcatcggctcc
A0A8B9CUX0_BCL2L1-      tcgac---------aaggagatgcgggtactggtggggcgcatcg-----
                        *  *            *****                    ***      

A0A8B9CVY0_BCL2A1-      ttc------attacagagtac----atcataaacaacaaagccgaatgga
A0A8B9C4H4_BCL2-01      -ccgcctggatgaccgagtacctgaaccggcacct----gcacaactgga
A0A8B9BNC2_MCL1-01      ttggccaggatcatcacagacgcg-ctcgtctcgtccaagcgcgagtggc
A0A8B9CUX0_BCL2L1-      -tggcgtggatgaccacgtacttg-accgac-catctagaccc--ctgga
                                 ** *      **      *              *   *** 

A0A8B9CVY0_BCL2A1-      tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttg-----
A0A8B9C4H4_BCL2-01      tccaggacaacggaggctggg---atgccttcgtggagttgtatggcaac
A0A8B9BNC2_MCL1-01      tgctgagccagggaggctggg---agggcttcgtcgacttcttccga---
A0A8B9CUX0_BCL2L1-      tccaggagaacggcggatggg---agcggtttgtggacctctacgggaac
                        *        * ** ** ****   *    **  *       *        

A0A8B9CVY0_BCL2A1-      -----------------aaagaagatcactactgtctttctccaaaa---
A0A8B9C4H4_BCL2-01      a----------------gtatgaggcctttgttcgatttctcctggatct
A0A8B9BNC2_MCL1-01      -----------------gtggaagacctaga--aggcagcatcaggaacg
A0A8B9CUX0_BCL2L1-      gacgctgctgcggaggtgaggaagggccagg--agac--cttcaacaaat
                                              **  *            *  *   *   

A0A8B9CVY0_BCL2A1-      --ttacagacatattcg----tagctcttttttccttgttcagagagtac
A0A8B9C4H4_BCL2-01      ctctgaagactatcctgagtttgg---------ttctggtgggagcttgc
A0A8B9BNC2_MCL1-01      tgctgatggcgttcgcgggggtggcagga---------ctgggagcgagc
A0A8B9CUX0_BCL2L1-      ggctcctgaccggggcgacggtggccggagtgctcctgctgggatc----
                           *   * *      *    * *               *  **      

A0A8B9CVY0_BCL2A1-      t---------------------------actga
A0A8B9C4H4_BCL2-01      atcactcttggcgcttatctcggacataagtag
A0A8B9BNC2_MCL1-01      tt---------ggcctacatgatccg---gtga
A0A8B9CUX0_BCL2L1-      -------------cctgc-tgagccgcaagtga

© 1998-2023Legal notice