Dataset for CDS Unclassified of Organism Anas platyrhynchos platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3IMW3_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos (length=447 residues).
atgtcccagacacagagaagccccaggcactttgttctctccagctaccctgaaggagatccagaagatgaaatgtatgg
caaccttctggcagcgccagatactgcagagcaaatggagtttaatatcagctcagctgtccaggttggccatcacctgg
ctctaattggggacgattttaacagagcatacagcaggaagattgaagatacactgcttcacctggcacatggggttgct
gtcagtgttttccagacatggaatattattaaaagcattacaagaagatttggaaatattttgaacaataactggacaaa
gaggatcgctggttatggaagctggatttgtcggcttcctttcaggtgcgtctgccagaagctggtgcctgcagccttgc
ttgctgttgcattttggtgggccataagttatggactgcagaattaa
© 1998-2020Legal notice