Dataset for CDS MCL-1 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N4PRP1_MCL1-01      atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattg
A0A7N4PRP1_MCL1-02      atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattg
A0A7N4PRP1_MCL1-03      atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattg
                        **************************************************

A0A7N4PRP1_MCL1-01      cgggggggccggcttgggcgccggcagcggcgccagcgcttccccgtccg
A0A7N4PRP1_MCL1-02      cgggggggccggcttgggcgccggcagcggcgccagcgcttccccgtccg
A0A7N4PRP1_MCL1-03      cgggggggccggcttgggcgccggcagcggcgccagcgcttccccgtccg
                        **************************************************

A0A7N4PRP1_MCL1-01      gcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccg
A0A7N4PRP1_MCL1-02      gcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccg
A0A7N4PRP1_MCL1-03      gcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccg
                        **************************************************

A0A7N4PRP1_MCL1-01      ccgcggctggacggaggggaagtgggagcgagcaccacgacgacggcagc
A0A7N4PRP1_MCL1-02      ccgcggctggacggaggggaagtgggagcgagc-----------------
A0A7N4PRP1_MCL1-03      ccgcggctggacggaggggaagtgggagcgagcaccacgacgacggcagc
                        *********************************                 

A0A7N4PRP1_MCL1-01      ggcggcggtagggttaaggggcggaagcggcggcgcgaatccccccgacc
A0A7N4PRP1_MCL1-02      -gcggcggtagggttaaggggcggaagcggcggcgcgaatccccccgacc
A0A7N4PRP1_MCL1-03      ggcggcggtagggttaaggggcggaagcggcggcgcgaatccccccgacc
                         *************************************************

A0A7N4PRP1_MCL1-01      ccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcg
A0A7N4PRP1_MCL1-02      ccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcg
A0A7N4PRP1_MCL1-03      ccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcg
                        **************************************************

A0A7N4PRP1_MCL1-01      gaggctcgcgacgtcaccgccccgccgagaccgttctttttcgcgccggg
A0A7N4PRP1_MCL1-02      gaggctcgcgacgtcaccgccccgccgagaccgttctttttcgcgccggg
A0A7N4PRP1_MCL1-03      gaggctcgcgacgtcaccgccccgccgagaccgttctttttcgcgccggg
                        **************************************************

A0A7N4PRP1_MCL1-01      cggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
A0A7N4PRP1_MCL1-02      cggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
A0A7N4PRP1_MCL1-03      cggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
                        **************************************************

A0A7N4PRP1_MCL1-01      tcctatcccccgaggacgagctggacggttacgagcccgagctccccggg
A0A7N4PRP1_MCL1-02      tcctatcccccgaggacgagctggacggttacgagcccgagctccccggg
A0A7N4PRP1_MCL1-03      tcctatcccccgaggacgagctggacggttacgagcccgagctccccggg
                        **************************************************

A0A7N4PRP1_MCL1-01      aagcggcccgctcgcctggccatgctgcccttggccagagagggtgggga
A0A7N4PRP1_MCL1-02      aagcggcccgctcgcctggccatgctgcccttggccagagagggtgggga
A0A7N4PRP1_MCL1-03      aagcggcccgctcgcctggccatgctgcccttggccagagagggtgggga
                        **************************************************

A0A7N4PRP1_MCL1-01      cacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccg
A0A7N4PRP1_MCL1-02      cacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccg
A0A7N4PRP1_MCL1-03      cacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccg
                        **************************************************

A0A7N4PRP1_MCL1-01      aggaggacgaggacgaggaggaggatgagttgtacgggcagtccttggag
A0A7N4PRP1_MCL1-02      aggaggacgaggacgaggaggaggatgagttgtacgggcagtccttggag
A0A7N4PRP1_MCL1-03      aggaggacgaggacgaggaggaggatgagttgtacgggcagtccttggag
                        **************************************************

A0A7N4PRP1_MCL1-01      ttgataacccgatacctccgcgagcaggcggtcggcaccaaggacaccaa
A0A7N4PRP1_MCL1-02      ttgataacccgatacctccgcgagcaggcggtcggcaccaaggacaccaa
A0A7N4PRP1_MCL1-03      ttgataacccgatacctccgcgagcaggcggtcggcaccaaggacaccaa
                        **************************************************

A0A7N4PRP1_MCL1-01      gcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacg
A0A7N4PRP1_MCL1-02      gcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacg
A0A7N4PRP1_MCL1-03      gcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacg
                        **************************************************

A0A7N4PRP1_MCL1-01      gtgtccagaggaaccacgagacggctttccaaggtatgcttcgcaaactg
A0A7N4PRP1_MCL1-02      gtgtccagaggaaccacgagacggctttccaaggtatgcttcgcaaactg
A0A7N4PRP1_MCL1-03      gtgtccagaggaaccacgagacggctttccaaggtatgcttcgcaaactg
                        **************************************************

A0A7N4PRP1_MCL1-01      gatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
A0A7N4PRP1_MCL1-02      gatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
A0A7N4PRP1_MCL1-03      gatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
                        **************************************************

A0A7N4PRP1_MCL1-01      tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcattt
A0A7N4PRP1_MCL1-02      tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcattt
A0A7N4PRP1_MCL1-03      tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcattt
                        **************************************************

A0A7N4PRP1_MCL1-01      ctttcggggcctttgtggcaaagcacttgaagagcataaaccaggaaagt
A0A7N4PRP1_MCL1-02      ctttcggggcctttgtggcaaagcacttgaagagcataaaccaggaaagt
A0A7N4PRP1_MCL1-03      ctttcggggcctttgtggcaaagcacttgaagagcataaaccaggaaagt
                        **************************************************

A0A7N4PRP1_MCL1-01      tgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaa
A0A7N4PRP1_MCL1-02      tgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaa
A0A7N4PRP1_MCL1-03      tgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaa
                        **************************************************

A0A7N4PRP1_MCL1-01      aagggactggctgatgaagcagaagggctgggagatgcccctgtgtgacc
A0A7N4PRP1_MCL1-02      aagggactggctgatgaagcagaagggctgggagg---------------
A0A7N4PRP1_MCL1-03      aagggactggctgatgaagcagaagggctgggagg---------------
                        **********************************                

A0A7N4PRP1_MCL1-01      tcagatggtccctgcaacccagcccttctccagtaatgaaccttcttgtc
A0A7N4PRP1_MCL1-02      ------ggtttgtggaattc------tttcatgtagaggacct-------
A0A7N4PRP1_MCL1-03      ------ggtttgtggaattc------tttcatgtagaggacct-------
                              ***   ** **  *      * **  ***  * ****       

A0A7N4PRP1_MCL1-01      tccgagtattcaaaaggtagt----ggactgggtgtcttatgtgagcaag
A0A7N4PRP1_MCL1-02      -----------agaaggtggcatcagaaatgtgctgctcgcctttgccgg
A0A7N4PRP1_MCL1-03      -----------agaaggtggcatcagaaatgtgctgctcgcctttgccgg
                                   * ***** *     * * ** *   **    *  **  *

A0A7N4PRP1_MCL1-01      gttggcaatatctggtgctggtgcccttttggttagctttgcta--aagg
A0A7N4PRP1_MCL1-02      tgttgctggagtaggagctggt----------ttggcatatctaataaga
A0A7N4PRP1_MCL1-03      tgttgctggagtaggagctggt----------ttggcatatctaataaga
                          * **   *   ** ******          ** ** *  ***  *** 

A0A7N4PRP1_MCL1-01      tgttttga
A0A7N4PRP1_MCL1-02      tag-----
A0A7N4PRP1_MCL1-03      tag-----
                        *       

© 1998-2021Legal notice