Dataset for CDS BOK of Organism Anas platyrhynchos platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3ISP2_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BOK (length=642 residues).
atggaagtgcttcgccgatcctcagtcttcgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagctaaggctctctgcagagactacataaattcgaggctggttcgagcaggtgtcagctggagcaaacccg
agtgcaacgctccggtgcctggtgggaagctggccgaggtgtccaccatcctgctgcggctgggagatgagctggaatac
attcgccccaacgtctaccggaacatcgcccgccagctgaacatctctctgcactcggagacggtggtgacggacgcctt
cctggctgtagccgcgcagattttcaccgcaggcataacgtggggcaaggtggtgtctctctacgcggtggcggcggggc
tggcagtggactgtgtgcggcacgcacagccagccatggtgcacaccatcgttgactgcctgggagagttcgtccgcaag
accttggtgacctggctgaaaaggcgaggaggctgggcagacatcacgaagtgtgttgtgaatactgaccccagccttcg
ctcccactggctcgtggctgctgtttgcagctttgggcacttcctcaaggcgatcttcttcgtgctgctgcctgagagat
ga
© 1998-2020Legal notice