Dataset for CDS BOK of Organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N5JPV0_BOK-01      --------------------------------------------------
A0A7N5JPV0_BOK-02      --------------------------------------------------
A0A7N5JPV0_BOK-03      atggtggcgatggaggtctcctccagggggccgggtttaagctgcaggca
                                                                         

A0A7N5JPV0_BOK-01      --------------------------------------------------
A0A7N5JPV0_BOK-02      --------------------------------------------------
A0A7N5JPV0_BOK-03      gaggaggcagggcacggcctcaggcaccccggacacagaccagcccttcc
                                                                         

A0A7N5JPV0_BOK-01      --------------------------------------------------
A0A7N5JPV0_BOK-02      --------------------------------------------------
A0A7N5JPV0_BOK-03      ttccacgccactccagacccgtcgccagggccctaactcgaccacctctc
                                                                         

A0A7N5JPV0_BOK-01      ------------------------------------------atggaggt
A0A7N5JPV0_BOK-02      ------------------------------------------atggaggt
A0A7N5JPV0_BOK-03      tcccgggggaggggtgccgcgcccctggcccgcgtccccgccatggaggt
                                                                 ********

A0A7N5JPV0_BOK-01      gctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgacc
A0A7N5JPV0_BOK-02      gctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgacc
A0A7N5JPV0_BOK-03      gctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgacc
                       **************************************************

A0A7N5JPV0_BOK-01      gctcgcccaccgacaaggagctggtggcccaggccaaggcgctcggccgg
A0A7N5JPV0_BOK-02      gctcgcccaccgacaaggagctggtggcccaggccaaggcgctcggccgg
A0A7N5JPV0_BOK-03      gctcgcccaccgacaaggagctggtggcccaggccaaggcgctcggccgg
                       **************************************************

A0A7N5JPV0_BOK-01      gagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgcc
A0A7N5JPV0_BOK-02      gagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgcc
A0A7N5JPV0_BOK-03      gagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgcc
                       **************************************************

A0A7N5JPV0_BOK-01      ggagcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccg
A0A7N5JPV0_BOK-02      ggagcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccg
A0A7N5JPV0_BOK-03      ggagcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccg
                       **************************************************

A0A7N5JPV0_BOK-01      tgctgctgcgcctgggggacgagctggagctgatccggcccagcgtctac
A0A7N5JPV0_BOK-02      tgctgctgcgcctgggggacgagctggagctgatccggcccagcgtctac
A0A7N5JPV0_BOK-03      tgctgctgcgcctgggggacgagctggagctgatccggcccagcgtctac
                       **************************************************

A0A7N5JPV0_BOK-01      cgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggt
A0A7N5JPV0_BOK-02      cgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggt
A0A7N5JPV0_BOK-03      cgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggt
                       **************************************************

A0A7N5JPV0_BOK-01      gaccgacgccttcctggctgtggcgtctcagatcttctctggagaacc--
A0A7N5JPV0_BOK-02      gaccgacgccttcctggctgtggcgtctcagatcttctctggagggcccc
A0A7N5JPV0_BOK-03      gaccgacgccttcctggctgtggcgtctcagatcttctctggag------
                       ********************************************      

A0A7N5JPV0_BOK-01      --------------------------------------------------
A0A7N5JPV0_BOK-02      tccttggaaccctgctgggctctctgttgtccgtagacctccatagacct
A0A7N5JPV0_BOK-03      --------------------------------------------------
                                                                         

A0A7N5JPV0_BOK-01      ---------------------------------cgtggccacactctgga
A0A7N5JPV0_BOK-02      catctccccacctgtgacctcatgtcgtgtcctcgtacctgcgctctgca
A0A7N5JPV0_BOK-03      -----------------------------------------------gca
                                                                      * *

A0A7N5JPV0_BOK-01      acccacgaggcctgcggccacacccacacct----gctgcgag-------
A0A7N5JPV0_BOK-02      tcacatggggcaaggtggtgtccctgtactcggtggccgcggggctggcc
A0A7N5JPV0_BOK-03      tcacatggggcaaggtggtgtccctgtactcggtggccgcggggctggcc
                        * ** * ***  *  *     **   **      ** *** *       

A0A7N5JPV0_BOK-01      ------cgtctacggagaagccgaagggtcacgacacacactcggggtca
A0A7N5JPV0_BOK-02      gtagactgtgtgcggcaggcccagcctgccatggtccacgctctcgtcga
A0A7N5JPV0_BOK-03      gtagactgtgtgcggcaggcccagcctgccatggtccacgctctcgtcga
                              ** * ***     **     * ** *   *** ***  *   *

A0A7N5JPV0_BOK-01      cggggtcaccttcttgtaggtgatgtg---aagatgctgagtcatgggct
A0A7N5JPV0_BOK-02      ctg--------ccttggggagtttgtgcgcaagaccctggcaccctggct
A0A7N5JPV0_BOK-03      ctg--------ccttggggagtttgtgcgcaagaccctggcaccctggct
                       * *         ****  *    ****   ****  ***   *   ****

A0A7N5JPV0_BOK-01      gggtagtggtcgccatgga--gactgtc-tgttcaagtttgccttcagaa
A0A7N5JPV0_BOK-02      gcgaa---gacgcggtggatggaccgacgtcctcaagtgtgtggtcagca
A0A7N5JPV0_BOK-03      gcgaa---gacgcggtggatggaccgacgtcctcaagtgtgtggtcagca
                       * * *   * ***  ****  *** * * *  ****** **   **** *

A0A7N5JPV0_BOK-01      ttcagcctgaattttcgggtgatctgagcagaacaaatacaaacacctta
A0A7N5JPV0_BOK-02      cggagcccggcttc-----cgctcccactggctcgtggccgcactctgca
A0A7N5JPV0_BOK-03      cggagcccggcttc-----cgctcccactggctcgtggccgcactctgca
                          **** *  **       * **  *   *  *     *  ** *   *

A0A7N5JPV0_BOK-01      gtttt----accttccaaaggcggccctgccacgggccaagtgtttggtt
A0A7N5JPV0_BOK-02      gctttggccgcttcctgaaggc-------------------tgctttctt
A0A7N5JPV0_BOK-03      gctttggccgcttcctgaaggc-------------------tgctttctt
                       * ***     * * *  *****                   ** **  **

A0A7N5JPV0_BOK-01      cgcgctcaacgtgccgcccccgttgtcagaggcctgtg------------
A0A7N5JPV0_BOK-02      cgtgct---------------gttgccggagagatgagctgtgggctccg
A0A7N5JPV0_BOK-03      cgtgct---------------gttgccggagagatga-------------
                       ** ***               **** * ***   **              

A0A7N5JPV0_BOK-01      --------------------------------------------------
A0A7N5JPV0_BOK-02      gcacaggctgaagcccggtgctccgacccagaaggccctgggcccccaag
A0A7N5JPV0_BOK-03      --------------------------------------------------
                                                                         

A0A7N5JPV0_BOK-01      ---ggacgtgtcctcgccagtggg--------------------------
A0A7N5JPV0_BOK-02      agcatccatgtcctcctcgaccaggctgggaaggctctgacgttcagagc
A0A7N5JPV0_BOK-03      --------------------------------------------------
                                                                         

A0A7N5JPV0_BOK-01      ---------------------------tga
A0A7N5JPV0_BOK-02      cccgcttctgtgctggaggccctgccctga
A0A7N5JPV0_BOK-03      ------------------------------
                                                     

© 1998-2023Legal notice