Dataset for CDS BOK of Organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A7N5JPV0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=708 residues).
atggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgccgg
agcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccgtgctgctgcgcctgggggacgagctggagctg
atccggcccagcgtctaccgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggtgaccgacgcctt
cctggctgtggcgtctcagatcttctctggagaacccgtggccacactctggaacccacgaggcctgcggccacacccac
acctgctgcgagcgtctacggagaagccgaagggtcacgacacacactcggggtcacggggtcaccttcttgtaggtgat
gtgaagatgctgagtcatgggctgggtagtggtcgccatggagactgtctgttcaagtttgccttcagaattcagcctga
attttcgggtgatctgagcagaacaaatacaaacaccttagttttaccttccaaaggcggccctgccacgggccaagtgt
ttggttcgcgctcaacgtgccgcccccgttgtcagaggcctgtgggacgtgtcctcgccagtgggtga
>gnl|bcl2dbcds|A0A7N5JPV0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=888 residues).
atggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgccgg
agcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccgtgctgctgcgcctgggggacgagctggagctg
atccggcccagcgtctaccgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggtgaccgacgcctt
cctggctgtggcgtctcagatcttctctggagggcccctccttggaaccctgctgggctctctgttgtccgtagacctcc
atagacctcatctccccacctgtgacctcatgtcgtgtcctcgtacctgcgctctgcatcacatggggcaaggtggtgtc
cctgtactcggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccatggtccacgctctcgtcgact
gccttggggagtttgtgcgcaagaccctggcaccctggctgcgaagacgcggtggatggaccgacgtcctcaagtgtgtg
gtcagcacggagcccggcttccgctcccactggctcgtggccgcactctgcagctttggccgcttcctgaaggctgcttt
cttcgtgctgttgccggagagatgagctgtgggctccggcacaggctgaagcccggtgctccgacccagaaggccctggg
cccccaagagcatccatgtcctcctcgaccaggctgggaaggctctgacgttcagagccccgcttctgtgctggaggccc
tgccctga
>gnl|bcl2dbcds|A0A7N5JPV0_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=834 residues).
atggtggcgatggaggtctcctccagggggccgggtttaagctgcaggcagaggaggcagggcacggcctcaggcacccc
ggacacagaccagcccttccttccacgccactccagacccgtcgccagggccctaactcgaccacctctctcccggggga
ggggtgccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggac
gcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggct
gctgcgcgccggcctcgcctggagcgcgccggagcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccg
tgctgctgcgcctgggggacgagctggagctgatccggcccagcgtctaccgcaacgtggctcgccagctgaacatctcc
ctgcagtctgaaaccgtggtgaccgacgccttcctggctgtggcgtctcagatcttctctggaggcatcacatggggcaa
ggtggtgtccctgtactcggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccatggtccacgctc
tcgtcgactgccttggggagtttgtgcgcaagaccctggcaccctggctgcgaagacgcggtggatggaccgacgtcctc
aagtgtgtggtcagcacggagcccggcttccgctcccactggctcgtggccgcactctgcagctttggccgcttcctgaa
ggctgctttcttcgtgctgttgccggagagatga
© 1998-2023Legal notice