Dataset for CDS BAX of Organism Calidris pygmaea

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3J127_BAX-01      --------------------------------------------------
A0A8C3K3A8_BAX-01      atggtgaagagttccaggaacccccaagcggtggccctgagccaggagga
                                                                         

A0A8C3J127_BAX-01      --------------------------------------------------
A0A8C3K3A8_BAX-01      attggggggggacccccagagcccccccaactccttcatccaactcctga
                                                                         

A0A8C3J127_BAX-01      ---------------------------atc--------------------
A0A8C3K3A8_BAX-01      tcaagtgcctgtgccgcaccgggggtgatctggaccagaacaccgagctc
                                                  ***                    

A0A8C3J127_BAX-01      ---------attgaagaagttgggtgccaggcctccaaagggctcttctt
A0A8C3K3A8_BAX-01      cagagcttgataaaaaaagtggagggcgagtcccccaaagaggtcttctt
                                **  ** **** * * ** ** ** ****** * *******

A0A8C3J127_BAX-01      ccgggtggccactgagctcttcgccgacggcaacttcaactggggccgcg
A0A8C3K3A8_BAX-01      caaggtggccaaggggatgttcgccgacggcaagttcaactggggccgcg
                       *  ********  * * * ************** ****************

A0A8C3J127_BAX-01      tcgtcaccctcttctatttcgcctgcaaactggtgctgaagtctcttcgc
A0A8C3K3A8_BAX-01      tcaccgccttcttctatttcgccagcaaactggcggtgaaggctctttgc
                       **  * ** ************** ********* * ***** ***** **

A0A8C3J127_BAX-01      caacaaatccccgagttggtgaggaccatcctgggctggaccctggagtt
A0A8C3K3A8_BAX-01      aaaaacatcccccaagtggtgaagaacatcatgggctgtgccatggagtt
                        ** * ****** *  ****** ** **** *******  ** *******

A0A8C3J127_BAX-01      cctgcgggagcgtgtcctggcctggatccaggctcaaggaggatgggaag
A0A8C3K3A8_BAX-01      cctgaggtcgcgcctcctgggctggatcaaggataaaggaggatg----g
                       **** **  ***  ****** ******* *** * **********    *

A0A8C3J127_BAX-01      gttctt--------------------acagattgccagtgatcaatacgc
A0A8C3K3A8_BAX-01      gttcctcgcctactttggcaccaacaacaggaaaaccgtagccg--acgc
                       **** *                    ****     * **   *   ****

A0A8C3J127_BAX-01      tgcccgcaaagcacctgccggtggcc---------------aaggggcca
A0A8C3K3A8_BAX-01      cgctggcaaagccctcactggagccctcaccgactttatcggagccacca
                        **  ******* *   * ** * **                **   ***

A0A8C3J127_BAX-01      gtgggatcct-----------------gggctgcc---------------
A0A8C3K3A8_BAX-01      ccggagccctcaccagagccgccattggagctgccaccggagccgccacc
                         **   ***                 * ******               

A0A8C3J127_BAX-01      -----------------------tggg-----------------------
A0A8C3K3A8_BAX-01      acaggcgtcatcggagccgtcattggagccctcaccggagccctcaccgg
                                              ***                        

A0A8C3J127_BAX-01      ------------caaga----------gcgtggccaggaggtgg------
A0A8C3K3A8_BAX-01      agccttcaccgccaagaagatgttgttgtagggctgggggtttgggtttt
                                   *****          *   ***  ** * * *      

A0A8C3J127_BAX-01      ------------------agggaggacgtt----ctcccccctctgctct
A0A8C3K3A8_BAX-01      tttgggggggccaccggcagggatggtgctgacacacccccctcccctcc
                                         ***** *  * *    * ********  *** 

A0A8C3J127_BAX-01      gtcccaggtggagcactgggaccagttctgggctccccagttcaagaggg
A0A8C3K3A8_BAX-01      tcccc--------cacc--------ttttgtgcctcccgg-----gaggg
                         ***        ***         ** ** **  *** *     *****

A0A8C3J127_BAX-01      acaggga-----actgctggggagagtccaacgtag
A0A8C3K3A8_BAX-01      ttggggacaatcattgtattaggaatatgtaggtag
                          ****     * **     *  *     * ****

© 1998-2023Legal notice