Dataset for CDS BAX of Organism Calidris pygmaea

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3J127_BAX-01 BCL2-associated X gene OS=[Eukaryota] Calidris pygmaea GN=BAX (length=462 residues).
atcattgaagaagttgggtgccaggcctccaaagggctcttcttccgggtggccactgagctcttcgccgacggcaactt
caactggggccgcgtcgtcaccctcttctatttcgcctgcaaactggtgctgaagtctcttcgccaacaaatccccgagt
tggtgaggaccatcctgggctggaccctggagttcctgcgggagcgtgtcctggcctggatccaggctcaaggaggatgg
gaaggttcttacagattgccagtgatcaatacgctgcccgcaaagcacctgccggtggccaaggggccagtgggatcctg
ggctgcctgggcaagagcgtggccaggaggtggagggaggacgttctcccccctctgctctgtcccaggtggagcactgg
gaccagttctgggctccccagttcaagagggacagggaactgctggggagagtccaacgtag
>gnl|bcl2dbcds|A0A8C3K3A8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Calidris pygmaea GN=BAX (length=759 residues).
atggtgaagagttccaggaacccccaagcggtggccctgagccaggaggaattggggggggacccccagagcccccccaa
ctccttcatccaactcctgatcaagtgcctgtgccgcaccgggggtgatctggaccagaacaccgagctccagagcttga
taaaaaaagtggagggcgagtcccccaaagaggtcttcttcaaggtggccaaggggatgttcgccgacggcaagttcaac
tggggccgcgtcaccgccttcttctatttcgccagcaaactggcggtgaaggctctttgcaaaaacatcccccaagtggt
gaagaacatcatgggctgtgccatggagttcctgaggtcgcgcctcctgggctggatcaaggataaaggaggatgggttc
ctcgcctactttggcaccaacaacaggaaaaccgtagccgacgccgctggcaaagccctcactggagccctcaccgactt
tatcggagccaccaccggagccctcaccagagccgccattggagctgccaccggagccgccaccacaggcgtcatcggag
ccgtcattggagccctcaccggagccctcaccggagccttcaccgccaagaagatgttgttgtagggctgggggtttggg
tttttttgggggggccaccggcagggatggtgctgacacacccccctcccctcctcccccaccttttgtgcctcccggga
gggttggggacaatcattgtattaggaatatgtaggtag
© 1998-2023Legal notice