Dataset for CDS BCL2L1 of organism Coregonus sp balchen

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6F8ZUL6_BCL2L1-      ---atgtcttacagtaacagggaactggtggtgttttttataagctataa
A0A6F9CY91_BCL2L1-      ---atgtcttacagtaacagggaactggtagtgttttttataagctatag
A0A6F9B188_BCL2L1-      atgatgacttacaacaacagagaactggtggtttactatattacctataa
A0A6F9BJ02_BCL2L1-      atgatgacttacaacaacagagaactggtggaatactatattacctataa
                           *** ******  ***** ******** *  *  * *** * ***** 

A0A6F8ZUL6_BCL2L1-      actgtcccagagaaattatccatgttgtcaattggtgctggagggtgcaa
A0A6F9CY91_BCL2L1-      actgtcccagaggaattattcattttgtcaattggggctggagggtgtaa
A0A6F9B188_BCL2L1-      actatcacagagagactaccccttcaaccacactgggctcacagaagctc
A0A6F9BJ02_BCL2L1-      actatcacagagggactaccccttcaatcacattgggctcacggaatccc
                        *** ** *****  * **  * *     **    * ***    *      

A0A6F8ZUL6_BCL2L1-      gtggacggactgagggggaag-----aagccattgcaaatgggtctttgg
A0A6F9CY91_BCL2L1-      gtggacggactgagggagatg-----aggccattgcaaatgggtctgtgg
A0A6F9B188_BCL2L1-      ccagtcagactgaggggggtgagggtggacaggtggaagggggggcggca
A0A6F9BJ02_BCL2L1-      agagtcggactgagggg---------ggaccggtggacgggagtgcggca
                           * * *********             *   ** *   * *       

A0A6F8ZUL6_BCL2L1-      ggaacaacagg----aatggca---------gaagcaatttgggtaag--
A0A6F9CY91_BCL2L1-      ggaacaacagg----aacagca---------gaagcaatttagggaag--
A0A6F9B188_BCL2L1-      gtcacgacacaccccaacggcacagtaaacgggacgagtcctgggact--
A0A6F9BJ02_BCL2L1-      gtcatgacatacgtcaactgcacaatgaacgggacgagtcctggtactcc
                        *  *  ***      **  ***         * *  * *   ** *    

A0A6F8ZUL6_BCL2L1-      -------------------ccttcatctccacaggg------gggcattg
A0A6F9CY91_BCL2L1-      -------------------ccctcatctccactggg------gggaattg
A0A6F9B188_BCL2L1-      -ccaccgcgacagtctcccccctctacccctcagcggacaatgggcctgg
A0A6F9BJ02_BCL2L1-      accaccacggcagtcacccccctcctcccctcggcggacagagggcctgg
                                           ** **  * ** * * *      ***  * *

A0A6F8ZUL6_BCL2L1-      aggcagtgaaagcagcactacgggactcagtggatgagtttgagctgcgc
A0A6F9CY91_BCL2L1-      aggcagtgaaagcagcactacgggactcagcggatgagtttgagctgcgc
A0A6F9B188_BCL2L1-      atgcagtgaaagaggcactgcgggactctgccaatgagtttgagctgcgt
A0A6F9BJ02_BCL2L1-      acgcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgt
                        * **********  ***** ******** *   * ************** 

A0A6F8ZUL6_BCL2L1-      tacacccgcgccttcagtgacctttcctcccagctccacatcacccctgc
A0A6F9CY91_BCL2L1-      tacaccagagccttcagtgacctcgcctcccaactccacatcacccctgc
A0A6F9B188_BCL2L1-      tatgccagagcgttcagtgacctgtcctcccagctgcacatcacgccggc
A0A6F9BJ02_BCL2L1-      tatgccagagcgttcagtgacctggcctcccagctgcacatcacgccgtc
                        **  ** * ** ***********  ******* ** ******** **  *

A0A6F8ZUL6_BCL2L1-      cacagcctaccacagctttgagagcgtgatggacgaagtgttcagggacg
A0A6F9CY91_BCL2L1-      cacagcctaccacagctttgagagcgtgatggacgaagtgttcagggacg
A0A6F9B188_BCL2L1-      cacagcctaccagagcttcgagaacgtgatggacgaggttttccgggacg
A0A6F9BJ02_BCL2L1-      cacagcctaccagagcttcgagaacgtgatggacgaggtgttccgggacg
                        ************ ***** **** ************ ** *** ******

A0A6F8ZUL6_BCL2L1-      gggtcaactggggtcgcgtggtgggcctgtttgctttcggcggggccctg
A0A6F9CY91_BCL2L1-      gggtcaactggggccgcgtggtgggcctatttgcttttggcggggccctg
A0A6F9B188_BCL2L1-      gtgtgaactggggacgggtggtgggcctgtttgccttcggaggggccctc
A0A6F9BJ02_BCL2L1-      gtgtgaactggggacgggtggttggcctgtttgccttcggaggggccctc
                        * ** ******** ** ***** ***** ***** ** ** ******** 

A0A6F8ZUL6_BCL2L1-      tgcattgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgc
A0A6F9CY91_BCL2L1-      tgtgttgaatgtgttgagaaggatatgagccccctggtggcacgcatcgc
A0A6F9B188_BCL2L1-      tgtgtagagtgcgtggagaaggagatgagcccactagtgggacggattgc
A0A6F9BJ02_BCL2L1-      tgtgtagagtgtgtggacaaggagatgagccctctggtgggaaggatcac
                        **  * ** ** ** ** ***** *******  ** ***    * **  *

A0A6F8ZUL6_BCL2L1-      agactggatggccacctacctggacaaccatatccagccctggatccaga
A0A6F9CY91_BCL2L1-      agactggatgaccacctacctggacaaccatatccagccctggatccaga
A0A6F9B188_BCL2L1-      agaatggatgaccgtctacctggacaaccacatccagccttggatccaga
A0A6F9BJ02_BCL2L1-      agactggatgacagtctacctggacaaccacatccagccctggatccaga
                        *** ****** *   *************** ******** **********

A0A6F8ZUL6_BCL2L1-      gccaaggaggatggg-----------------------------------
A0A6F9CY91_BCL2L1-      gccaaggaggatggg-----------------------------------
A0A6F9B188_BCL2L1-      gccaaggaggatggatgaaagcagcgttttctctggggtcagctgagaga
A0A6F9BJ02_BCL2L1-      gccaaggaggatgggtga--------------------------------
                        **************                                    

A0A6F8ZUL6_BCL2L1-      -------------------------------------------------a
A0A6F9CY91_BCL2L1-      -------------------------------------------------a
A0A6F9B188_BCL2L1-      ggggttgtcctgttcctggtgggtgggtgtgttatgggatggaaggagga
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
                                                                          

A0A6F8ZUL6_BCL2L1-      ctgttttgcggagatcttcggcagagatgcagctgcagacgtccgacggt
A0A6F9CY91_BCL2L1-      ccgttttgcagagatctttggcagagatgctgctgcagatgtccgacggt
A0A6F9B188_BCL2L1-      cactgttaaagagatctttgggaaggacgctgcagccgagagcaggaagt
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
                                                                          

A0A6F8ZUL6_BCL2L1-      cccaggagagcttaagaaaatggctgctagttggggtgatgctgctttca
A0A6F9CY91_BCL2L1-      cccaggagagcgtaataaaatggctgctagttggggtgattctgttttca
A0A6F9B188_BCL2L1-      ctcaggagagctttaagaagtggctgctggcggggatgacgctggtcaca
A0A6F9BJ02_BCL2L1-      --------------------------------------------gtcacg
                                                                     *  * 

A0A6F8ZUL6_BCL2L1-      ggagtactggtcggcactctcatcatgaagaaacgccagtga
A0A6F9CY91_BCL2L1-      ggagtgctggtcggcactctcatcatgaagaaacgccagtga
A0A6F9B188_BCL2L1-      ggagtcgtcgtagggtcactcatcgctcagaaacgcctgtga
A0A6F9BJ02_BCL2L1-      a-------------------------------------ctga
                                                               ***

© 1998-2020Legal notice