Dataset for CDS BCL2L1 of organism Coregonus sp balchen

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A6F8ZUL6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcaatt
ggtgctggagggtgcaagtggacggactgagggggaagaagccattgcaaatgggtctttggggaacaacaggaatggca
gaagcaatttgggtaagccttcatctccacaggggggcattgaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgcgccttcagtgacctttcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgctttcggcggggccc
tgtgcattgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggactgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A6F9B188_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=789 residues).
atgatgacttacaacaacagagaactggtggtttactatattacctataaactatcacagagagactaccccttcaacca
cactgggctcacagaagctcccagtcagactgaggggggtgagggtggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtaaacgggacgagtcctgggactccaccgcgacagtctcccccctctacccctcagcggacaatg
ggcctggatgcagtgaaagaggcactgcgggactctgccaatgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggacgaggttttccgggacggtg
tgaactggggacgggtggtgggcctgtttgccttcggaggggccctctgtgtagagtgcgtggagaaggagatgagccca
ctagtgggacggattgcagaatggatgaccgtctacctggacaaccacatccagccttggatccagagccaaggaggatg
gatgaaagcagcgttttctctggggtcagctgagagaggggttgtcctgttcctggtgggtgggtgtgttatgggatgga
aggaggacactgttaaagagatctttgggaaggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtgg
ctgctggcggggatgacgctggtcacaggagtcgtcgtagggtcactcatcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A6F9BJ02_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=570 residues).
atgatgacttacaacaacagagaactggtggaatactatattacctataaactatcacagagggactaccccttcaatca
cattgggctcacggaatcccagagtcggactgaggggggaccggtggacgggagtgcggcagtcatgacatacgtcaact
gcacaatgaacgggacgagtcctggtactccaccaccacggcagtcacccccctcctcccctcggcggacagagggcctg
gacgcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctggcctc
ccagctgcacatcacgccgtccacagcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggtgtgaact
ggggacgggtggttggcctgtttgccttcggaggggccctctgtgtagagtgtgtggacaaggagatgagccctctggtg
ggaaggatcacagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatgggtgag
tcacgactga
>gnl|bcl2dbcds|A0A6F9CY91_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtagtgttttttataagctatagactgtcccagaggaattattcattttgtcaatt
ggggctggagggtgtaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacaacaggaacagca
gaagcaatttagggaagccctcatctccactggggggaattgaggcagtgaaagcagcactacgggactcagcggatgag
tttgagctgcgctacaccagagccttcagtgacctcgcctcccaactccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggccgcgtggtgggcctatttgcttttggcggggccc
tgtgtgttgaatgtgttgagaaggatatgagccccctggtggcacgcatcgcagactggatgaccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagatgt
ccgacggtcccaggagagcgtaataaaatggctgctagttggggtgattctgttttcaggagtgctggtcggcactctca
tcatgaagaaacgccagtga
© 1998-2020Legal notice