Dataset for CDS BCL-2-like of organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W6DDI0_BCL2-01      ----atggcgagcgagtgta------------------------------
A0A4W6BQD5_BCL2L1-      ----atgt------------------------------------------
A0A4W6EST2_BCL2L1-      ----atgtcgtac-agcaacagagag------------------------
A0A4W6FHH7_BCL2L10      ----atgtcatgcgggctgtggaaagagacc-----------ctggtt--
A0A4W6CDF4_MCL1-03      atgaatatcattccaacaacgaagcg-gaccgccctcatgaactgtttta
A0A4W6CDF4_MCL1-01      atgaatatcattccaacaacgaagcg-gaccgccctcatgaactgtttta
A0A4W6CDF4_MCL1-02      atgaatatcattccaacaacgaagcg-gaccgccctcatgaactgtttta
                            **                                            

A0A4W6DDI0_BCL2-01      ------atcgcaatatcgtggaaaagtatatctgccataaact-------
A0A4W6BQD5_BCL2L1-      ------ctcaaaacagagaactggtggtttt-ctacataaagt----ata
A0A4W6EST2_BCL2L1-      ------ct---agtggagtt------------ctttataagct----aca
A0A4W6FHH7_BCL2L10      ------ctggcagaggactacctgtgcctttgctgcacaagcccagggcc
A0A4W6CDF4_MCL1-03      ttcttcctcaaaatggagtcgcggagggactgcactac-agctcaggaga
A0A4W6CDF4_MCL1-01      ttcttcctcaaaatggagtcgcggagggactgcactac-agctcaggaga
A0A4W6CDF4_MCL1-02      ttcttcctcaaaatggagtcgcggagggactgcactac-agctcaggaga
                               *   *                        *  *          

A0A4W6DDI0_BCL2-01      -------------------------------------------------c
A0A4W6BQD5_BCL2L1-      aactctctcagaga-aactatccactcaaccacatggaactcaatgagcc
A0A4W6EST2_BCL2L1-      agctttctcagag--------------------------------gaacc
A0A4W6FHH7_BCL2L10      agcccctccac--------------------------------------c
A0A4W6CDF4_MCL1-03      ttcctcaccacagatcgccatgggctcaactata-----------gactc
A0A4W6CDF4_MCL1-01      ttcctcaccacagatcgccatgggctcaactata-----------gactc
A0A4W6CDF4_MCL1-02      ttcctcaccacagatcgccatgggctcaactata-----------gactc
                                                                         *

A0A4W6DDI0_BCL2-01      tccaaacggggctacgtgtggcggtgtgaca--acgtccgggat------
A0A4W6BQD5_BCL2L1-      tccaaacaggactga-tgggg----gggaggcagggtcaagtga------
A0A4W6EST2_BCL2L1-      acccaacctctctgc-tgaggccagaggatg-ctggtggaaggactg---
A0A4W6FHH7_BCL2L10      tcccagcgagtcagc-cgctgccatgagacgcattgcccagg--------
A0A4W6CDF4_MCL1-03      tcgcaacgggaatgt-tgggtccccaaagcg----gcccaagaacttgga
A0A4W6CDF4_MCL1-01      tcgcaacgggaatgt-tgggtccccaaagcg----gcccaagaacttgga
A0A4W6CDF4_MCL1-02      tcgcaacgggaatgt-tgggtccccaaagcg----gcccaagaacttgga
                         *  * *          *                 *              

A0A4W6DDI0_BCL2-01      ------------gaagatgctgctaataacgggtcgatagtttcccctcc
A0A4W6BQD5_BCL2L1-      ------------ggaagagcggatagcaacacacgc----------caac
A0A4W6EST2_BCL2L1-      ----------------agggagataagaccaa-ctcagct----------
A0A4W6FHH7_BCL2L10      ------------acatggagacacagcaccaggctcgttt----------
A0A4W6CDF4_MCL1-03      agtcagctcaacaaatgggtatccagcaaaaagc-cgtcttgaggacagc
A0A4W6CDF4_MCL1-01      agtcagctcaacaaatgggtatccagcaaaaagc-cgtcttgaggacagc
A0A4W6CDF4_MCL1-02      agtcagctcaacaaatgggtatccagcaaaaagc-cgtcttgaggacagc
                                                *  *                      

A0A4W6DDI0_BCL2-01      gccgactttggtacaccggtgccgcgaagccagcgggcccgacgacaacg
A0A4W6BQD5_BCL2L1-      ggaacttttaacagcacgagtcctgggacccctccagcgtccccactgcg
A0A4W6EST2_BCL2L1-      ---gccagtaacggcttgctggtcaacagcagggacaggtgtggtcagca
A0A4W6FHH7_BCL2L10      -----------ccactcccttgctcagaccctgctgaggcagtgcgggcc
A0A4W6CDF4_MCL1-03      gacgtcgacgacggctctttgccgtgtaccccggagctgcagt-cggaca
A0A4W6CDF4_MCL1-01      gacgtcgacgacggctctttgccgtgtaccccggagctgcagt-cggaca
A0A4W6CDF4_MCL1-02      gacgtcgacgacggctctttgccgtgtaccccggagctgcagt-cggaca
                                                   * *                  * 

A0A4W6DDI0_BCL2-01      agagcgtccccaacctgcgcaggcggctcaaccctcagcccgacccg-ta
A0A4W6BQD5_BCL2L1-      ----------------gcagcaacggttgccatcaacgacgagcctg---
A0A4W6EST2_BCL2L1-      ----------------gggggcgccatcgcccctgcgtggtggcata---
A0A4W6FHH7_BCL2L10      ----------------g-------gacccctgctctagcct--cagg---
A0A4W6CDF4_MCL1-03      ----------------gtgaaatcgatgtctccagttgtccagcagggga
A0A4W6CDF4_MCL1-01      ----------------gtgaaatcgatgtctccagttgtccagcagggga
A0A4W6CDF4_MCL1-02      ----------------gtgaaatcgatgtctccagttgtccagcagggga
                                        *                          *      

A0A4W6DDI0_BCL2-01      cgccgccatccaca------------------------gagtcctgcgcg
A0A4W6BQD5_BCL2L1-      -gatgcggtgaaag------------------------aggccctccggg
A0A4W6EST2_BCL2L1-      -gaggctgtaaagg-----------------------cagctc-ttaggg
A0A4W6FHH7_BCL2L10      -aaggtgatggagg------------------------agctggtgggag
A0A4W6CDF4_MCL1-03      cgaagtgttggagaatgataccaggcaactgattagccagttcatgagag
A0A4W6CDF4_MCL1-01      cgaagtgttggagaatgataccaggcaactgattagccagttcatgagag
A0A4W6CDF4_MCL1-02      cgaagtgttggagaatgataccaggcaactgattagccagttcatgagag
                            *   *  *                                *  * *

A0A4W6DDI0_BCL2-01      aggctggagacgaacttgagag--------------------actgtacc
A0A4W6BQD5_BCL2L1-      actcggccaacgagtttgagtt--------------------gcgatatg
A0A4W6EST2_BCL2L1-      actctgctgacgagtttgaact--------------------gctcttca
A0A4W6FHH7_BCL2L10      ac------gg-acgcttgaactggggg-----------------------
A0A4W6CDF4_MCL1-03      actttactgg-actttcgaaaccacggtggaataaaagcaaagcactacc
A0A4W6CDF4_MCL1-01      actttactgg-actttcgaaaccacggtggaataaaagcaaagcactacc
A0A4W6CDF4_MCL1-02      actttactgg-actttcgaaaccacggtggaataaaagcaaagcactacc
                        *              * **                               

A0A4W6DDI0_BCL2-01      agcc------ggacttcac--ggagatgtcgcggcagctgtacctcacct
A0A4W6BQD5_BCL2L1-      cccg------cgccttcag--cgatctgcacaaccagctgcacatcacgc
A0A4W6EST2_BCL2L1-      ccca------agcgttcag--tgacctttcctcgcagcttgacatcactc
A0A4W6FHH7_BCL2L10      ----------agggttgt---ttccctttt---------------cacct
A0A4W6CDF4_MCL1-03      aacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcat
A0A4W6CDF4_MCL1-01      aacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcat
A0A4W6CDF4_MCL1-02      aacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcat
                                   *  **          *                  * *  

A0A4W6DDI0_BCL2-01      ccacc----------acggcgcagaggaggttcgccgaggtgatagacga
A0A4W6BQD5_BCL2L1-      cggcc----------acagcttaccaaagcttcgagaacgtgatggatga
A0A4W6EST2_BCL2L1-      ctgac----------acagcctaccacagctttaagagtgtgatggatga
A0A4W6FHH7_BCL2L10      ttactggggtgctggccagacagctgcag------------ga--gcaga
A0A4W6CDF4_MCL1-03      acaacggtatgatcaacaaactgtcgttg------------gatgacaga
A0A4W6CDF4_MCL1-01      acaacggtatgatcaacaaactgtcgttg------------gatgacaga
A0A4W6CDF4_MCL1-02      acaacggtatgatcaacaaactgtcgttg------------gatgacaga
                                        *           *            **     **

A0A4W6DDI0_BCL2-01      ac--------------------------------------tgttccggga
A0A4W6BQD5_BCL2L1-      ag--------------------------------------tgttccggga
A0A4W6EST2_BCL2L1-      gg--------------------------------------tgttcaagga
A0A4W6FHH7_BCL2L10      gg------------------------------------------ctgggg
A0A4W6CDF4_MCL1-03      ggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggaga
A0A4W6CDF4_MCL1-01      ggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggaga
A0A4W6CDF4_MCL1-02      ggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggaga
                                                                    *   * 

A0A4W6DDI0_BCL2-01      cggggtg---aactggggccggattatcgcattcttcgagttcgggggca
A0A4W6BQD5_BCL2L1-      cggcgtc---aactggggccgcatcatagggctttttgcgttcggcgggg
A0A4W6EST2_BCL2L1-      tggtgtc---aactggggacgtatagtgggtctgtttgcctttgggggtg
A0A4W6FHH7_BCL2L10      ctggaccccaggcagggg--------------------------------
A0A4W6CDF4_MCL1-03      cggcaccacaaactggggtcgtattgccagcctggtggccttcggcgcag
A0A4W6CDF4_MCL1-01      cggcaccacaaactggggtcgtattgccagcctggtggccttcggcgcag
A0A4W6CDF4_MCL1-02      cggcaccacaaactggggtcgtattgccagcctggtggccttcggcgcag
                          *         * ****                                

A0A4W6DDI0_BCL2-01      ccgtgtgcgtggagtgcgcggccaaggaggacatg---acgtcgcaggtg
A0A4W6BQD5_BCL2L1-      cgctgtgtgtcgagtgtgtgg---agaaggagatgagtccactg---gtg
A0A4W6EST2_BCL2L1-      tactgtgtgtggaatgtgtcg---agaagaatatgagtgagctg---gtt
A0A4W6FHH7_BCL2L10      --------caggaact--ggg---acaggagcccg-g-aaactgcaggga
A0A4W6CDF4_MCL1-03      tggtgtgtcagcacctaaagg---agaggggcagg-gtggactgtgtgga
A0A4W6CDF4_MCL1-01      tggtgtgtcagcacctaaagg---agaggggcagg-gtggactgtgtgga
A0A4W6CDF4_MCL1-02      tggtgtgtcagcacctaaagg---agaggggcagg-gtggactgtgtgga
                                    *       *   *   *     *        *   *  

A0A4W6DDI0_BCL2-01      gacaacatcgcggagtggatgacggagtattta-aatggacctcttaaca
A0A4W6BQD5_BCL2L1-      ggcaggatcgtggagtggatgacagtttacctg-gacaaccacattcagc
A0A4W6EST2_BCL2L1-      tcccgcattgcagactggatgaccatgtacctg-gatgagcgcatcagtc
A0A4W6FHH7_BCL2L10      actggcgg---agac--catagctgattaccttggagaggagaagaaaga
A0A4W6CDF4_MCL1-03      tcttgtggggcagga--gatcgccacatatctgctgtcagaccagcggga
A0A4W6CDF4_MCL1-01      tcttgtggggcagga--gatcgccacatatctgctgtcagaccagcggga
A0A4W6CDF4_MCL1-02      tcttgtggggcagga--gatcgccacatatctgctgtcagaccagcggga
                                    *     **  *    **  *                  

A0A4W6DDI0_BCL2-01      gctggataaaagataacgggggatgggatgcctttgtggagctgt-----
A0A4W6BQD5_BCL2L1-      cctggatccagagtcaaggaggatgggagcgctttgcagaaatctttggg
A0A4W6EST2_BCL2L1-      cgtggattcagagccaaggaggctgggactgctttgctgagatttttggg
A0A4W6FHH7_BCL2L10      c-tggctgctggagaatgatggatgggaggggttctgtaagttctct---
A0A4W6CDF4_MCL1-03      c-tggcttgtgaaaaacaactcctgggatggctttgtggagttcttt---
A0A4W6CDF4_MCL1-01      c-tggcttgtgaaaaacaactcctgggatggctttgtggagttcttt---
A0A4W6CDF4_MCL1-02      c-tggcttgtgaaaaacaactcctgggatggctttgtggagttcttt---
                          *** *        *       *****    **     *  * *     

A0A4W6DDI0_BCL2-01      ---------acgacagacagagggagtccgtcttcagttgctcctggccc
A0A4W6BQD5_BCL2L1-      caggatgcagcagcagagagcaggaggtc-----------ccaggagagc
A0A4W6EST2_BCL2L1-      caagacgcagctgcagaagcgaggagatc-----------tcgggagact
A0A4W6FHH7_BCL2L10      -----catgccgccagagaggtgaa---------------ccacgactcg
A0A4W6CDF4_MCL1-03      -----cacg-tatcag--------a---------------cccagaatca
A0A4W6CDF4_MCL1-01      -----cacg-tatcag--------a---------------cccagaatca
A0A4W6CDF4_MCL1-02      -----cacg-tatcag--------a---------------cccagaatca
                                     ***        *                         

A0A4W6DDI0_BCL2-01      tccatcaagacggtcttcggcctggccgcgctcggggcggctagcctcac
A0A4W6BQD5_BCL2L1-      ttcaagaagtggctgc------tggcggggat-gaccctggtgac--cgg
A0A4W6EST2_BCL2L1-      atgaggagatggctgctag--ttggag----t-ggcgctgctaacaggag
A0A4W6FHH7_BCL2L10      tcgatgaagacggtgcttg--ttgccgctgct-ggcgt-----------g
A0A4W6CDF4_MCL1-03      acagtgaggaacacgctca--ttggccttgct-ggatttgctggtatcgg
A0A4W6CDF4_MCL1-01      acagtgaggaacacgctca--ttggccttgct-ggatttgctggtatcgg
A0A4W6CDF4_MCL1-02      acagtgaggaacacgctca--ttggccttgct-ggatttgctggtatcgg
                              *               **       * *                

A0A4W6DDI0_BCL2-01      catcggagcgtacc------------------------------------
A0A4W6BQD5_BCL2L1-      ggtcgtggtgggctcactga------------------------------
A0A4W6EST2_BCL2L1-      tgctggtcggtgtcc-----------------------------------
A0A4W6FHH7_BCL2L10      ggcctggctggactca----------------------------------
A0A4W6CDF4_MCL1-03      ggccacactggctttgttgatcagcaattacccagcagcaagagtgtttg
A0A4W6CDF4_MCL1-01      ggccacactggctttgttgatcaggtctttct---------gtgaatttg
A0A4W6CDF4_MCL1-02      ggccacactggctttgttgatcagatcctccc---------gttgtcttg
                                 *                                        

A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A4W6FHH7_BCL2L10      --------------------------------------------------
A0A4W6CDF4_MCL1-03      tat-gcaaggccaaggcaggaagggagagctgcatttttccatgtctt--
A0A4W6CDF4_MCL1-01      ggt--cagggc----------------------------tgaagtctt--
A0A4W6CDF4_MCL1-02      ggttacaggacaaacaca-------------acactcatcgaggtcttag
                                                                          

A0A4W6DDI0_BCL2-01      -------------------ttacgcagaag--------------------
A0A4W6BQD5_BCL2L1-      -------------------ttgctcagaagcgcctg--------------
A0A4W6EST2_BCL2L1-      ----------------tcgtcgctaagaaacag-----------------
A0A4W6FHH7_BCL2L10      ----------------ccttcctcatggtgcgc-----------------
A0A4W6CDF4_MCL1-03      ---gcagtcatgaagcccatttccatagagcccattgacaagcctcggat
A0A4W6CDF4_MCL1-01      ------------tcatcctcccccatgga---------------------
A0A4W6CDF4_MCL1-02      gaggaaatggagtagagcctctccatgg----------------------
                                                                          

A0A4W6DDI0_BCL2-01      ----------------------tga
A0A4W6BQD5_BCL2L1-      ----------------------tga
A0A4W6EST2_BCL2L1-      ----------------------tga
A0A4W6FHH7_BCL2L10      ----------------------tag
A0A4W6CDF4_MCL1-03      catttgtatggattcaactttgtga
A0A4W6CDF4_MCL1-01      ----------------------tga
A0A4W6CDF4_MCL1-02      ----------------------tga
                                              *  

© 1998-2020Legal notice