Dataset for CDS BCL-2-like of organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A4W6BQD5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctctcagagaaactatccactcaaccacatgga
actcaatgagcctccaaacaggactgatgggggggaggcagggtcaagtgaggaagagcggatagcaacacacgccaacg
gaacttttaacagcacgagtcctgggacccctccagcgtccccactgcggcagcaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacagcttaccaaagcttcgagaacgtgatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggatcgtggagtggatgacagtttacctggacaaccacattcagccctggatccagagtcaaggaggatgggagcg
ctttgcagaaatctttgggcaggatgcagcagcagagagcaggaggtcccaggagagcttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggtcgtggtgggctcactgattgctcagaagcgcctgtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=888 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcaggtctttctgtgaatttgggtcagggctgaagtctttcatcctccccc
atggatga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=918 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagatcctcccgttgtcttgggttacaggacaaacacaacactcatcgag
gtcttaggaggaaatggagtagagcctctccatggtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=978 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagcaattacccagcagcaagagtgtttgtatgcaaggccaaggcaggaa
gggagagctgcatttttccatgtcttgcagtcatgaagcccatttccatagagcccattgacaagcctcggatcatttgt
atggattcaactttgtga
>gnl|bcl2dbcds|A0A4W6DDI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lates calcarifer GN=BCL-2 (length=690 residues).
atggcgagcgagtgtaatcgcaatatcgtggaaaagtatatctgccataaactctccaaacggggctacgtgtggcggtg
tgacaacgtccgggatgaagatgctgctaataacgggtcgatagtttcccctccgccgactttggtacaccggtgccgcg
aagccagcgggcccgacgacaacgagagcgtccccaacctgcgcaggcggctcaaccctcagcccgacccgtacgccgcc
atccacagagtcctgcgcgaggctggagacgaacttgagagactgtaccagccggacttcacggagatgtcgcggcagct
gtacctcacctccaccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggcc
ggattatcgcattcttcgagttcgggggcaccgtgtgcgtggagtgcgcggccaaggaggacatgacgtcgcaggtggac
aacatcgcggagtggatgacggagtatttaaatggacctcttaacagctggataaaagataacgggggatgggatgcctt
tgtggagctgtacgacagacagagggagtccgtcttcagttgctcctggccctccatcaagacggtcttcggcctggccg
cgctcggggcggctagcctcaccatcggagcgtaccttacgcagaagtga
>gnl|bcl2dbcds|A0A4W6EST2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctagtggagttctttataagctacaagctttctcagaggaaccacccaacctctctgct
gaggccagaggatgctggtggaaggactgagggagataagaccaactcagctgccagtaacggcttgctggtcaacagca
gggacaggtgtggtcagcagggggcgccatcgcccctgcgtggtggcatagaggctgtaaaggcagctcttagggactct
gctgacgagtttgaactgctcttcacccaagcgttcagtgacctttcctcgcagcttgacatcactcctgacacagccta
ccacagctttaagagtgtgatggatgaggtgttcaaggatggtgtcaactggggacgtatagtgggtctgtttgcctttg
ggggtgtactgtgtgtggaatgtgtcgagaagaatatgagtgagctggtttcccgcattgcagactggatgaccatgtac
ctggatgagcgcatcagtccgtggattcagagccaaggaggctgggactgctttgctgagatttttgggcaagacgcagc
tgcagaagcgaggagatctcgggagactatgaggagatggctgctagttggagtggcgctgctaacaggagtgctggtcg
gtgtcctcgtcgctaagaaacagtga
>gnl|bcl2dbcds|A0A4W6FHH7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L10 (length=576 residues).
atgtcatgcgggctgtggaaagagaccctggttctggcagaggactacctgtgcctttgctgcacaagcccagggccagc
ccctccacctcccagcgagtcagccgctgccatgagacgcattgcccaggacatggagacacagcaccaggctcgtttcc
actcccttgctcagaccctgctgaggcagtgcgggccggacccctgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacgcttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgcaggagca
gaggctggggctggaccccaggcaggggcaggaactgggacaggagcccggaaactgcagggaactggcggagaccatag
ctgattaccttggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctctcatgcc
gccagagaggtgaaccacgactcgtcgatgaagacggtgcttgttgccgctgctggcgtgggcctggctggactcacctt
cctcatggtgcgctag
© 1998-2020Legal notice