Dataset for CDS BCL-2 of organism Oryzias javanicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3S2PV78_BCL2-01      --------------------------------------------------
A0A3S2PV78_BCL2-02      --------------------------------------------------
A0A3S2PV78_BCL2-03      atgtcctctaaagaaggcttcagttcagctgtcaccgattggcttttcat
A0A3S2PV78_BCL2-04      atgtcctctaaagaaggcttcagttcagctgtcaccgattggcttttcat

A0A3S2PV78_BCL2-01      ----------------------------------------atggcgaacg
A0A3S2PV78_BCL2-02      -------------------------------atgctcctgatagtggtcg
A0A3S2PV78_BCL2-03      caattcctggtggatcctgctgccttttattatgctcctgatagtggtcg
A0A3S2PV78_BCL2-04      caattcctggtggatcctgctgccttttattatgctcctgatagtggtcg
                                                                ** * *  **

A0A3S2PV78_BCL2-01      tgtctcatcgcag------------tattgtagaaaa-------gtacat
A0A3S2PV78_BCL2-02      cct-tcattgttgccttcgtgttgctgctgtacatgatatcgccgctcat
A0A3S2PV78_BCL2-03      cct-tcattgttgccttcgtgttgctgctgtacatgatatcgccgctcat
A0A3S2PV78_BCL2-04      cct-tcattgttgccttcgtgttgctgctgtacatgatatcgccgctcat
                          * **** *  *            *  **** *  *       *  ***

A0A3S2PV78_BCL2-01      ttgccacaaactctccaaga-------ggggctacgt-------------
A0A3S2PV78_BCL2-02      tagtc-caaagcctctgaaattaaacggggcccacgtcgtggtgaccgga
A0A3S2PV78_BCL2-03      tagtc-caaagcctctgaaattaaacggggcccacgtcgtggtgaccgga
A0A3S2PV78_BCL2-04      tagtc-caaagcctctgaaattaaacggggcccacgtcgtggtgaccgga
                        * * * ****  ***  * *       *** * ****             

A0A3S2PV78_BCL2-01      -gttcggcttggacggcggccagca---cga--ggatgccgctaataa--
A0A3S2PV78_BCL2-02      ggctcaggtggaattgggaaaagcattgcgatcgaatgcttcagacaagg
A0A3S2PV78_BCL2-03      ggctcaggtggaattgggaaaagcattgcgatcgaatgcttcagacaagg
A0A3S2PV78_BCL2-04      ggctcaggtggaattgggaaaagcattgcgatcgaatgcttcagacaagg
                         * ** * * * *  * *   ****   ***  * ****  *  * **  

A0A3S2PV78_BCL2-01      -------------cggctcgctcg--------------------------
A0A3S2PV78_BCL2-02      agcctttatcactctggttgctcgtgatgaggataaattactcaaagcaa
A0A3S2PV78_BCL2-03      agcctttatcactctggttgctcgtgatgaggataaattactcaaagcaa
A0A3S2PV78_BCL2-04      agcctttatcactctggttgctcgtgatg---------------------
                                     * * * *****                          

A0A3S2PV78_BCL2-01      ------------------------------------------------gt
A0A3S2PV78_BCL2-02      agaaggaggtggagaagttcgcaatcaatgacaaacaggtggtgttgtgt
A0A3S2PV78_BCL2-03      agaaggaggtggagaagttcgcaatcaatgacaaacaggtggtgttgtgt
A0A3S2PV78_BCL2-04      ------------------------------------aggtggtgttgtgt

A0A3S2PV78_BCL2-01      g-accgttccccgactccggtccgccgccgctgcgacgcgggaacggggc
A0A3S2PV78_BCL2-02      gtatcggtcgacatctccagt--gattacact-caagtggaaaatgtgat
A0A3S2PV78_BCL2-03      gtatcggtcgacatctccagt--gattacact-caagtggaaaatgtgat
A0A3S2PV78_BCL2-04      gtatcggtcgacatctccagt--gattacact-caagtggaaaatgtgat
                        * * ** **  *  **** **  *    * ** * *   *  ** * *  

A0A3S2PV78_BCL2-01      ctgacgg---cgagcgcagccc---ccgcctcatccgcgcgctggagccg
A0A3S2PV78_BCL2-02      aaaacaggctcaagagaagctcggaccagttgatatgctcgt--gaactg
A0A3S2PV78_BCL2-03      aaaacaggctcaagagaagctcggaccagttgatatgctcgt--gaactg
A0A3S2PV78_BCL2-04      aaaacaggctcaagagaagctcggaccagttgatatgctcgt--gaactg
                           ** *   * ** * *** *   **   * **  ** **   ** * *

A0A3S2PV78_BCL2-01      cacgcggacatccacagagtcctgcgggaggctggagacgagctggagcg
A0A3S2PV78_BCL2-02      cgctggaacagccgtcgc------tgggaagtttgag--gagatggag--
A0A3S2PV78_BCL2-03      cgctggaacagccgtcgc------tgggaagtttgag--gagatggag--
A0A3S2PV78_BCL2-04      cgctggaacagccgtcgc------tgggaagtttgag--gagatggag--
                        * *  * *** **   *        **** * * ***  *** *****  

A0A3S2PV78_BCL2-01      gctgtaccagcgggac--ttcacggagatgtcgcggcagctgtacct---
A0A3S2PV78_BCL2-02      ---------gtggaacgtttcaaagagttgatggaggtgaattacctggg
A0A3S2PV78_BCL2-03      ---------gtggaacgtttcaaagagttgatggaggtgaattacctggg
A0A3S2PV78_BCL2-04      ---------gtggaacgtttcaaa--------------------------
                                 * ** **  ****                            

A0A3S2PV78_BCL2-01      ---------------------cacctccaccacggcgaagacccggttcg
A0A3S2PV78_BCL2-02      cagcgtctacccaacacgagccgtcataaccaccatgaaggagcggagaa
A0A3S2PV78_BCL2-03      cagcgtctacccaacacgagccgtcataaccaccatgaaggagcggagaa
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      ccgaggtgatcg---------------------------acgaactgttc
A0A3S2PV78_BCL2-02      tgggtcggatcgtgttcgtctcctcccagtttgctctgcgcggatt----
A0A3S2PV78_BCL2-03      tgggtcggatcgtgttcgtctcctcccaggcgggacagatcggccttttc
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      cgggacggggtgaac----------------------tggggccg-----
A0A3S2PV78_BCL2-02      --------ggcggaatcgctgcaaa------tggagatgaagccgtacaa
A0A3S2PV78_BCL2-03      ggatatacggcttactctccttcaagtttgctctgcatgaagccgtacaa
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      ---------gattatcgcgttcttcgagttcgggggcac------cgtgt
A0A3S2PV78_BCL2-02      catctatgtgactgtggcgttcccccctgacacggacacgccactgctgg
A0A3S2PV78_BCL2-03      catctatgtgactgtggcgttcccccctgacacggacacgccactgctgg
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      gcgtggagtgcgcgtccga------------cgaggaga----tgagcgc
A0A3S2PV78_BCL2-02      ccgaagaaaacaagtccaagcctttagagaccaagttgatctctgaaacc
A0A3S2PV78_BCL2-03      ccgaagaaaacaagtccaagcctttagagaccaagttgatctctgaaacc
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      gcaggtggccagcatc---gccgagtggatgacggaatatttaa------
A0A3S2PV78_BCL2-02      tctggagtctggcagccagaccaggtggccaaagtctttgtcaaagacgc
A0A3S2PV78_BCL2-03      tctggagtctggcagccagaccaggtggccaaagtctttgtcaaagacgc
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      -----acggacctctcaacagctggatagaagataacgg-----------
A0A3S2PV78_BCL2-02      cgtgcaaggaaacttcaacagctctgtgggtcctgatggttacatgctgt
A0A3S2PV78_BCL2-03      cgtgcaaggaaacttcaacagctctgtgggtcctgatggttacatgctgt
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      --------------gggatg------------------------------
A0A3S2PV78_BCL2-02      cggctctcacctgcggaatgtcacccgtcacctccatcacagaaggtctc
A0A3S2PV78_BCL2-03      cggctctcacctgcggaatgtcacccgtcacctccatcacagaaggtctc
A0A3S2PV78_BCL2-04      --------------------------------------------------

A0A3S2PV78_BCL2-01      -----ggatgcttttgtggagctgtacgacagacagaaggaaaccgtctt
A0A3S2PV78_BCL2-02      cagcaggatgcttttgtggagctgtacgacagacagaaggaaaccgtctt
A0A3S2PV78_BCL2-03      cagcagatcgtcaccatggggctgtttcgc------------accattgc
A0A3S2PV78_BCL2-04      ------atcgtcaccatggggctgtttcgc------------accattgc
                                 *      *** *****    *            *** *   

A0A3S2PV78_BCL2-01      cagctgctactggccgtccatcaagactgtcttcggc--ctggctgctct
A0A3S2PV78_BCL2-02      cagctgctactggccgtccatcaagactgtcttcggc--ctggctgctct
A0A3S2PV78_BCL2-03      tctcttctacctggggagtttcgacagcatcgtgcgccgctgcatgattc
A0A3S2PV78_BCL2-04      tctcttctacctggggagtttcgacagcatcgtgcgccgctgcatgattc
                           ** ****  *  *    ** * *   ** *  **  ***  ** *  

A0A3S2PV78_BCL2-01      cggggcggcgagcctgaccatcggagcataccttgcacaaaagtga
A0A3S2PV78_BCL2-02      cggggcggcgagcctgaccatcggagcataccttgcacaaaagtga
A0A3S2PV78_BCL2-03      agagggagcagtcgaaaacggctaacaagacc--------gagtaa
A0A3S2PV78_BCL2-04      agagggagcagtcgaaaacggctaacaagacc--------gagtaa
                         * **  **   *   * *  *  *  * ***         *** *

© 1998-2021Legal notice