Dataset for CDS BCL-2 of organism Oryzias javanicus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3S2PV78_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias javanicus GN=BCL-2 (length=678 residues).
atggcgaacgtgtctcatcgcagtattgtagaaaagtacatttgccacaaactctccaagaggggctacgtgttcggctt
ggacggcggccagcacgaggatgccgctaataacggctcgctcggtgaccgttccccgactccggtccgccgccgctgcg
acgcgggaacggggcctgacggcgagcgcagcccccgcctcatccgcgcgctggagccgcacgcggacatccacagagtc
ctgcgggaggctggagacgagctggagcggctgtaccagcgggacttcacggagatgtcgcggcagctgtacctcacctc
caccacggcgaagacccggttcgccgaggtgatcgacgaactgttccgggacggggtgaactggggccggattatcgcgt
tcttcgagttcgggggcaccgtgtgcgtggagtgcgcgtccgacgaggagatgagcgcgcaggtggccagcatcgccgag
tggatgacggaatatttaaacggacctctcaacagctggatagaagataacgggggatgggatgcttttgtggagctgta
cgacagacagaaggaaaccgtcttcagctgctactggccgtccatcaagactgtcttcggcctggctgctctcggggcgg
cgagcctgaccatcggagcataccttgcacaaaagtga
>gnl|bcl2dbcds|A0A3S2PV78_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias javanicus GN=BCL-2 (length=969 residues).
atgctcctgatagtggtcgccttcattgttgccttcgtgttgctgctgtacatgatatcgccgctcattagtccaaagcc
tctgaaattaaacggggcccacgtcgtggtgaccggaggctcaggtggaattgggaaaagcattgcgatcgaatgcttca
gacaaggagcctttatcactctggttgctcgtgatgaggataaattactcaaagcaaagaaggaggtggagaagttcgca
atcaatgacaaacaggtggtgttgtgtgtatcggtcgacatctccagtgattacactcaagtggaaaatgtgataaaaca
ggctcaagagaagctcggaccagttgatatgctcgtgaactgcgctggaacagccgtcgctgggaagtttgaggagatgg
aggtggaacgtttcaaagagttgatggaggtgaattacctgggcagcgtctacccaacacgagccgtcataaccaccatg
aaggagcggagaatgggtcggatcgtgttcgtctcctcccagtttgctctgcgcggattggcggaatcgctgcaaatgga
gatgaagccgtacaacatctatgtgactgtggcgttcccccctgacacggacacgccactgctggccgaagaaaacaagt
ccaagcctttagagaccaagttgatctctgaaacctctggagtctggcagccagaccaggtggccaaagtctttgtcaaa
gacgccgtgcaaggaaacttcaacagctctgtgggtcctgatggttacatgctgtcggctctcacctgcggaatgtcacc
cgtcacctccatcacagaaggtctccagcaggatgcttttgtggagctgtacgacagacagaaggaaaccgtcttcagct
gctactggccgtccatcaagactgtcttcggcctggctgctctcggggcggcgagcctgaccatcggagcataccttgca
caaaagtga
>gnl|bcl2dbcds|A0A3S2PV78_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias javanicus GN=BCL-2 (length=1050 residues).
atgtcctctaaagaaggcttcagttcagctgtcaccgattggcttttcatcaattcctggtggatcctgctgccttttat
tatgctcctgatagtggtcgccttcattgttgccttcgtgttgctgctgtacatgatatcgccgctcattagtccaaagc
ctctgaaattaaacggggcccacgtcgtggtgaccggaggctcaggtggaattgggaaaagcattgcgatcgaatgcttc
agacaaggagcctttatcactctggttgctcgtgatgaggataaattactcaaagcaaagaaggaggtggagaagttcgc
aatcaatgacaaacaggtggtgttgtgtgtatcggtcgacatctccagtgattacactcaagtggaaaatgtgataaaac
aggctcaagagaagctcggaccagttgatatgctcgtgaactgcgctggaacagccgtcgctgggaagtttgaggagatg
gaggtggaacgtttcaaagagttgatggaggtgaattacctgggcagcgtctacccaacacgagccgtcataaccaccat
gaaggagcggagaatgggtcggatcgtgttcgtctcctcccaggcgggacagatcggccttttcggatatacggcttact
ctccttcaagtttgctctgcatgaagccgtacaacatctatgtgactgtggcgttcccccctgacacggacacgccactg
ctggccgaagaaaacaagtccaagcctttagagaccaagttgatctctgaaacctctggagtctggcagccagaccaggt
ggccaaagtctttgtcaaagacgccgtgcaaggaaacttcaacagctctgtgggtcctgatggttacatgctgtcggctc
tcacctgcggaatgtcacccgtcacctccatcacagaaggtctccagcagatcgtcaccatggggctgtttcgcaccatt
gctctcttctacctggggagtttcgacagcatcgtgcgccgctgcatgattcagagggagcagtcgaaaacggctaacaa
gaccgagtaa
>gnl|bcl2dbcds|A0A3S2PV78_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias javanicus GN=BCL-2 (length=561 residues).
atgtcctctaaagaaggcttcagttcagctgtcaccgattggcttttcatcaattcctggtggatcctgctgccttttat
tatgctcctgatagtggtcgccttcattgttgccttcgtgttgctgctgtacatgatatcgccgctcattagtccaaagc
ctctgaaattaaacggggcccacgtcgtggtgaccggaggctcaggtggaattgggaaaagcattgcgatcgaatgcttc
agacaaggagcctttatcactctggttgctcgtgatgaggtggtgttgtgtgtatcggtcgacatctccagtgattacac
tcaagtggaaaatgtgataaaacaggctcaagagaagctcggaccagttgatatgctcgtgaactgcgctggaacagccg
tcgctgggaagtttgaggagatggaggtggaacgtttcaaaatcgtcaccatggggctgtttcgcaccattgctctcttc
tacctggggagtttcgacagcatcgtgcgccgctgcatgattcagagggagcagtcgaaaacggctaacaagaccgagta
a
© 1998-2020Legal notice