Dataset for CDS BCL-2 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5Y6Y3_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaa
A0A5F5Y6Y3_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaa
Q8I008_BCL2-01          atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
                        ******************************************** *****

A0A5F5Y6Y3_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtgggatgccgggg
A0A5F5Y6Y3_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgccgggg
Q8I008_BCL2-01          gtacatccactatgagctgccgcagaggggctacgagtgggatgccgggg
                        ************* ***** ******************************

A0A5F5Y6Y3_BCL2-02      acgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcc
A0A5F5Y6Y3_BCL2-01      acgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcc
Q8I008_BCL2-01          acgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcc
                        **************************************************

A0A5F5Y6Y3_BCL2-02      tcccagcccgggcgcacccctgcgcccgccaggacctccccgccgccgcc
A0A5F5Y6Y3_BCL2-01      tcccagcccgggcgcacccctgcgcccgccaggacctccccgccgccgcc
Q8I008_BCL2-01          tcccagcccgggcgcacccctgcgcccgccaggacctccccgccgccgcc
                        **************************************************

A0A5F5Y6Y3_BCL2-02      cccggtcgcccccgccgccgccgccgccgccgccgccgcgggccctgcgc
A0A5F5Y6Y3_BCL2-01      cccggtcgcccccgccgccgccgccgccgccgccgccgcgggccctgcgc
Q8I008_BCL2-01          cccggtcgccc------ccgccgccgccgccgctgccgcgggccctgcgc
                        ***********      **************** ****************

A0A5F5Y6Y3_BCL2-02      tcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgat
A0A5F5Y6Y3_BCL2-01      tcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgat
Q8I008_BCL2-01          tcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgat
                        **************************************************

A0A5F5Y6Y3_BCL2-02      gacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagct
A0A5F5Y6Y3_BCL2-01      gacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagct
Q8I008_BCL2-01          gacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagct
                        **************************************************

A0A5F5Y6Y3_BCL2-02      gcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
A0A5F5Y6Y3_BCL2-01      gcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
Q8I008_BCL2-01          gcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
                        **************************************************

A0A5F5Y6Y3_BCL2-02      agctcttcagggatggagtgaactgggggaggattgtggccttctttgag
A0A5F5Y6Y3_BCL2-01      agctcttcagggatggagtgaactgggggaggattgtggccttctttgag
Q8I008_BCL2-01          agctcttcagggatggcgtgaactgggggaggattgtggccttctttgag
                        **************** *********************************

A0A5F5Y6Y3_BCL2-02      ttcggtggggtcatgtgtgtggagagcgtcaaccgagagatgtcgcccct
A0A5F5Y6Y3_BCL2-01      ttcggtggggtcatgtgtgtggagagcgtcaaccgagagatgtcgcccct
Q8I008_BCL2-01          ttcggtggggtcatgtgtgtggagggcgtcaaccgagagatgtcgcccct
                        ************************ *************************

A0A5F5Y6Y3_BCL2-02      ggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgc
A0A5F5Y6Y3_BCL2-01      ggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgc
Q8I008_BCL2-01          ggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgc
                        **************************************************

A0A5F5Y6Y3_BCL2-02      acacctggatccaagacaacggaggctgg---------------------
A0A5F5Y6Y3_BCL2-01      acacctggatccaagacaacggaggctgggatgcctttgtggaactgtac
Q8I008_BCL2-01          acacctggatccaggataacggaggctgggatgcctttgtggaactgtac
                        ************* ** ************                     

A0A5F5Y6Y3_BCL2-02      ---ctaatcttgctgcctcgtacctcgtatgaattaaaaagctcccgggc
A0A5F5Y6Y3_BCL2-01      ggccccagcatgcagcctc------tgtttgattt-------ctcctggc
Q8I008_BCL2-01          ggccccagcatgcagcctc------tgtttgattt-------ctcctggc
                           *  * * *** *****       ** *** **         ** ***

A0A5F5Y6Y3_BCL2-02      tctccgtgaagac-------------------gtaagaatt----tcacc
A0A5F5Y6Y3_BCL2-01      tgtccctgaaggccctgctcagtctggccctggtgggggcttgcatcacc
Q8I008_BCL2-01          tgtccctgaaggccctgctcagtctggccctggtgggggcttgcatcacc
                        * *** ***** *                   **  *   *    *****

A0A5F5Y6Y3_BCL2-02      ct-----cttttctttttaaagactag
A0A5F5Y6Y3_BCL2-01      ctgggtgcctatctgggccacaagtga
Q8I008_BCL2-01          ctgggtgcctatctgggccacaagtga
                        **     * * ***     *  * *  

© 1998-2022Legal notice