Dataset for CDS BCL-2 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3X1R9_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccac
M3X1R9_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccac
Q8I008_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccac
                    ******************************************** ***************

M3X1R9_BCL2-02      tataagctgtcgcagaggggctacgagtgggatgccggggacgcgggcgccgcgcccccg
M3X1R9_BCL2-01      tataagctgtcgcagaggggctacgagtgggatgccggggacgcgggcgccgcgcccccg
Q8I008_BCL2-01      tatgagctgccgcagaggggctacgagtgggatgccggggacgcgggcgccgcgcccccg
                    *** ***** **************************************************

M3X1R9_BCL2-02      ggggccgcccccgcgccgggcatcttctcctcccagcccgggcgcacccctgcgcccgcc
M3X1R9_BCL2-01      ggggccgcccccgcgccgggcatcttctcctcccagcccgggcgcacccctgcgcccgcc
Q8I008_BCL2-01      ggggccgcccccgcgccgggcatcttctcctcccagcccgggcgcacccctgcgcccgcc
                    ************************************************************

M3X1R9_BCL2-02      aggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
M3X1R9_BCL2-01      aggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
Q8I008_BCL2-01      aggacctccccgccgccgcccccggtcgccc------ccgccgccgccgccgctgccgcg
                    *******************************      **************** ******

M3X1R9_BCL2-02      ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgat
M3X1R9_BCL2-01      ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgat
Q8I008_BCL2-01      ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgat
                    ************************************************************

M3X1R9_BCL2-02      gacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgaca
M3X1R9_BCL2-01      gacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgaca
Q8I008_BCL2-01      gacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgaca
                    ************************************************************

M3X1R9_BCL2-02      ccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggagtg
M3X1R9_BCL2-01      ccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggagtg
Q8I008_BCL2-01      ccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggcgtg
                    ******************************************************** ***

M3X1R9_BCL2-02      aactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
M3X1R9_BCL2-01      aactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
Q8I008_BCL2-01      aactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagggcgtc
                    ****************************************************** *****

M3X1R9_BCL2-02      aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
M3X1R9_BCL2-01      aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
Q8I008_BCL2-01      aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
                    ************************************************************

M3X1R9_BCL2-02      cggcacctgcacacctggatccaagacaacggaggctgg---------------------
M3X1R9_BCL2-01      cggcacctgcacacctggatccaagacaacggaggctgggatgcctttgtggaactgtac
Q8I008_BCL2-01      cggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaactgtac
                    *********************** ** ************                     

M3X1R9_BCL2-02      ---ctaatcttgctgcctcgtacctcgtatgaattaaaaagctcccgggctctccgtgaa
M3X1R9_BCL2-01      ggccccagcatgcagcctc------tgtttgattt-------ctcctggctgtccctgaa
Q8I008_BCL2-01      ggccccagcatgcagcctc------tgtttgattt-------ctcctggctgtccctgaa
                       *  * * *** *****       ** *** **         ** **** *** ****

M3X1R9_BCL2-02      gac-------------------gtaagaatt----tcaccct-----cttttctttttaa
M3X1R9_BCL2-01      ggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggcca
Q8I008_BCL2-01      ggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggcca
                    * *                   **  *   *    *******     * * ***     *

M3X1R9_BCL2-02      agactag
M3X1R9_BCL2-01      caagtga
Q8I008_BCL2-01      caagtga
                      * *  

© 1998-2020Legal notice