Dataset for CDS BCL2L1 of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q90Z98_BCL2L1-02      atgtcttactataaccgagaactggtggtattttttatcaaatataaact
Q90Z98_BCL2L1-01      atgtcttactataaccgagaactggtggtattttttatcaaatataaact

Q90Z98_BCL2L1-02      ctcgcagaggaactacccctgcaaccacattggacttacagaagacacaa
Q90Z98_BCL2L1-01      ctcgcagaggaactacccctgcaaccacattggacttacagaagacacaa

Q90Z98_BCL2L1-02      atcggactgatggggctgaagagaatggcgagggggcagcaggagcgaca
Q90Z98_BCL2L1-01      atcggactgatggggctgaagagaatggcgagggggcagcaggagcgaca

Q90Z98_BCL2L1-02      actcttgttaatggcaccatgaatagaacgaacgctagttccactgggac
Q90Z98_BCL2L1-01      actcttgttaatggcaccatgaatagaacgaacgctagttccactgggac

Q90Z98_BCL2L1-02      cccaccacaatcccctgcttcatccccccagcgtcaaacaaatgggtctg
Q90Z98_BCL2L1-01      cccaccacaatcccctgcttcatccccccagcgtcaaacaaatgggtctg

Q90Z98_BCL2L1-02      ggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagttt
Q90Z98_BCL2L1-01      ggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagttt

Q90Z98_BCL2L1-02      gagctgcgctattccagagcattcaacgatctttcctcacagctccacat
Q90Z98_BCL2L1-01      gagctgcgctattccagagcattcaacgatctttcctcacagctccacat

Q90Z98_BCL2L1-02      cacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
Q90Z98_BCL2L1-01      cacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt

Q90Z98_BCL2L1-02      ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcgga
Q90Z98_BCL2L1-01      ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcgga

Q90Z98_BCL2L1-02      ggggctctgtgcgtcgagtgtgtggagaaggagatgagtccgcttgtggg
Q90Z98_BCL2L1-01      ggggctctgtgcgtcgagtgtgtggagaaggagatgagtccgcttgtggg

Q90Z98_BCL2L1-02      acgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccct
Q90Z98_BCL2L1-01      acgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccct

Q90Z98_BCL2L1-02      ggatccaaagccaaggaggatgggaacgctttgcagagatctttggaaaa
Q90Z98_BCL2L1-01      ggatccaaagccaaggaggatgggaacgctttgcagagatctttggaaaa

Q90Z98_BCL2L1-02      gatgcagcggcggaaagcaggaaatcgcaagaaagcttcaagaaatggtt
Q90Z98_BCL2L1-01      gatgcagcggcggaaagcaggaaatcgcaagaaagcttcaagaaatggtt

Q90Z98_BCL2L1-02      gtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattg
Q90Z98_BCL2L1-01      gtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattg

Q90Z98_BCL2L1-02      cacagaaacgcctgtga
Q90Z98_BCL2L1-01      cacagaaacgcctgtga

© 1998-2020Legal notice