Dataset for CDS BCL2A1 of organism Panthera leo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C8X938_BCL2A1-      atggcggacggcgagtttgggtacgttctcacgctggcccgggactatac
A0A8C8X938_BCL2A1-      atggcgg-cggcga---------------------cggccgtga------
                        ******* ******                      * *** **      

A0A8C8X938_BCL2A1-      gaagcacgttctgcaggggccccagcccgggtgccacccaagcagagtat
A0A8C8X938_BCL2A1-      ------------gcagcg-------------------ccaagcggagc--
                                    **** *                   ****** ***   

A0A8C8X938_BCL2A1-      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag
A0A8C8X938_BCL2A1-      --------ctgcgggccg--------------------------------
                                ** *  * **                                

A0A8C8X938_BCL2A1-      cagctgaagccgtgcctggacaagttccacgtggggtcggtagacacggc
A0A8C8X938_BCL2A1-      -agctgaagcagcgtctg--------------------------------
                         ********* * * ***                                

A0A8C8X938_BCL2A1-      caggacgatgttccaccaagtgatggagaaggaatttgaagacggcatca
A0A8C8X938_BCL2A1-      -cgggcgat-----------------------------------------
                          ** ****                                         

A0A8C8X938_BCL2A1-      tcaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8X938_BCL2A1-      aagaagcttctccaggagcggatcgtcccagacgcggatgcgttcaaggt
A0A8C8X938_BCL2A1-      ---------------gagcg------ccgaggagcggctgcg--------
                                       *****      ** **  **** ****        

A0A8C8X938_BCL2A1-      ttcctacttcgttgccgagttcatcacgaaacacacgggagaatggatcc
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8X938_BCL2A1-      ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaag
A0A8C8X938_BCL2A1-      ---------------------------------------tcagtcccaac
                                                               **   ***** 

A0A8C8X938_BCL2A1-      tctggctggctgacctttctggaagttacaggaaagatctgtaaggtgat
A0A8C8X938_BCL2A1-      tct---tggc----------------------------ccagaaggtgat
                        ***   ****                            *   ********

A0A8C8X938_BCL2A1-      agctcacagtcagtatcagaagtcgaaaagaatctccatctttctgagca
A0A8C8X938_BCL2A1-      agctcacagtcagtatcagaagtcgaaaagaatctccatctttctgagca

A0A8C8X938_BCL2A1-      tgccagacgaagtcgagacagaagagatcatcagggacattttccggcaa
A0A8C8X938_BCL2A1-      tgccagacgaagtcgagacagaagagatcatcagggacattttccggcaa

A0A8C8X938_BCL2A1-      gggaagacctgcttcgtcccacggtaccggttccagaacaaccacatgga
A0A8C8X938_BCL2A1-      gggaagacctgcttcgtcccacggtaccggttccagaacaaccacatgga

A0A8C8X938_BCL2A1-      catgctgagactgacgtcccccgacgaaatttcgttacttcccaggacgt
A0A8C8X938_BCL2A1-      catgctgagactgacgtcccccgacgaaatttcgttacttcccaggacgt

A0A8C8X938_BCL2A1-      cctggaatatccttcagcctggagaggatgaggtccgggaggaagccttg
A0A8C8X938_BCL2A1-      cctggaatatccttcagcctggagaggatgaggtccgggaggaagccttg

A0A8C8X938_BCL2A1-      tccacagggggacttgatctcatctttgtgccgggtcttgggtttgacaa
A0A8C8X938_BCL2A1-      tccacagggggacttgatctcatctttgtgccgggtcttgggtttgacaa

A0A8C8X938_BCL2A1-      gcatggcaaccggctggggcggggcaagggctactacgactcctacctga
A0A8C8X938_BCL2A1-      gcatggcaaccggctggggcggggcaagggctactacgactcctacctga

A0A8C8X938_BCL2A1-      cgcgctgtctgcagcagcgggactcgaagccctacaccgtggccttggcg
A0A8C8X938_BCL2A1-      cgcgctgtctgcagcagcgggactcgaagccctacaccgtggccttggcg

A0A8C8X938_BCL2A1-      ttccgagaacagatgtgcctccgggtccccgtggacgaacacgacgtgag
A0A8C8X938_BCL2A1-      ttccgagaacagatgtgcctccgggtccccgtggacgaacacgacgtgag

A0A8C8X938_BCL2A1-      ggtggatgaagtcctttacgaagactccacgtag
A0A8C8X938_BCL2A1-      ggtggatgaagtcctttacgaagactccacgtag

© 1998-2023Legal notice