Dataset for CDS BCL2L1 of organism Peromyscus maniculatus bairdii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6I9LMY5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctgtcccagaaagggtacagctggagtcagtt
tagtgatgtcgaagaggacaggactgaggctccagaaggaactgattccgagagggagacccccagtgccgtcaatggca
acccatcctggcgcctggccgacagccccgcggtgaacggagccactggccacagcagcagtttggatgcgcgggaggtg
atccccatggcggcggtgaagcaggcgctgagagaggccggcgatgagtttgaactgcggtatcggcgggccttcagtga
tctaacatcccagcttcatataaccccagggacagcctatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcatcgtggcctttttctccttcggtggagccctgtgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagccgctgagagccgaaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice