Dataset for CDS MCL-1 of organism Catagonus wagneri

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C3W949_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=1095 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtagggggaggggaag
ccggcgcggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagatgcccggagggtcgcgcggccc
tcgcccattggcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacccgcctcgcgtc
gccgcccgaagagatggactccccggcctccgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggaggccagtagtggccccggcacggacggctca
ctcccctcgacgccgcccccggcagaggaggaggacgacgagttgtaccggcagtccctagagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggtgtggtcctttaaaaacaag
ttctacagctatgttttggagcagaggagacgcaacaggacttctgtggctgggcagagtgagaattcaaccagatggaa
gaaatcccagggacttagacttaggtactttcctgaggctttctacttcctgtaa
>gnl|bcl2dbcds|A0A8C3W949_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=1056 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtagggggaggggaag
ccggcgcggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagatgcccggagggtcgcgcggccc
tcgcccattggcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacccgcctcgcgtc
gccgcccgaagagatggactccccggcctccgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggaggccagtagtggccccggcacggacggctca
ctcccctcgacgccgcccccggcagaggaggaggacgacgagttgtaccggcagtccctagagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A8C3W949_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=597 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
© 1998-2022Legal notice