Dataset for CDS MCL-1 of organism Catagonus wagneri

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3W949_MCL1-01      atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgg
A0A8C3W949_MCL1-02      atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgg
A0A8C3W949_MCL1-03      atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgg
                        **************************************************

A0A8C3W949_MCL1-01      gggggccggactggggccgggtagcggcagcagtgcctccgctccgggag
A0A8C3W949_MCL1-02      gggggccggactggggccgggtagcggcagcagtgcctccgctccgggag
A0A8C3W949_MCL1-03      gggggccggactggggccgggtagcggcagcagtgcctccgctccgggag
                        **************************************************

A0A8C3W949_MCL1-01      ggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtaggg
A0A8C3W949_MCL1-02      ggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtaggg
A0A8C3W949_MCL1-03      ggcgcctctt----------------------------------------
                        **********                                        

A0A8C3W949_MCL1-01      ggaggggaagccggcgcggtgattggcggaagcgccggcgcgagcccccc
A0A8C3W949_MCL1-02      ggaggggaagccggcgcggtgattggcggaagcgccggcgcgagcccccc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      gtccactcctgcgccagatgcccggagggtcgcgcggccctcgcccattg
A0A8C3W949_MCL1-02      gtccactcctgcgccagatgcccggagggtcgcgcggccctcgcccattg
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      gcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttc
A0A8C3W949_MCL1-02      gcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      gcgcccacccgcctcgcgtcgccgcccgaagagatggactccccggcctc
A0A8C3W949_MCL1-02      gcgcccacccgcctcgcgtcgccgcccgaagagatggactccccggcctc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      cgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
A0A8C3W949_MCL1-02      cgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggag
A0A8C3W949_MCL1-02      ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggag
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      gccagtagtggccccggcacggacggctcactcccctcgacgccgccccc
A0A8C3W949_MCL1-02      gccagtagtggccccggcacggacggctcactcccctcgacgccgccccc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      ggcagaggaggaggacgacgagttgtaccggcagtccctagagattatct
A0A8C3W949_MCL1-02      ggcagaggaggaggacgacgagttgtaccggcagtccctagagattatct
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3W949_MCL1-01      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
A0A8C3W949_MCL1-02      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
A0A8C3W949_MCL1-03      -------------------ggcaaccggcgccaaggacgcgaagccaatg
                                           *******************************

A0A8C3W949_MCL1-01      ggcgggtgcggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A8C3W949_MCL1-02      ggcgggtgcggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A8C3W949_MCL1-03      ggcgggtgcggggccgccagccggaaggcgttagagaccctgcgacgggt
                        **************************************************

A0A8C3W949_MCL1-01      cggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttc
A0A8C3W949_MCL1-02      cggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttc
A0A8C3W949_MCL1-03      cggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttc
                        **************************************************

A0A8C3W949_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A8C3W949_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A8C3W949_MCL1-03      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
                        **************************************************

A0A8C3W949_MCL1-01      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A8C3W949_MCL1-02      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A8C3W949_MCL1-03      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
                        **************************************************

A0A8C3W949_MCL1-01      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A8C3W949_MCL1-02      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A8C3W949_MCL1-03      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
                        **************************************************

A0A8C3W949_MCL1-01      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
A0A8C3W949_MCL1-02      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
A0A8C3W949_MCL1-03      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
                        **************************************************

A0A8C3W949_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggtgtggtcctt
A0A8C3W949_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A8C3W949_MCL1-03      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
                        ****************************************   ***   *

A0A8C3W949_MCL1-01      taaaaacaagttctacagctatgttttggagcagaggagacgcaacagga
A0A8C3W949_MCL1-02      g------gagttct---tccatgtagagga-cctagaaggcggcatcaga
A0A8C3W949_MCL1-03      g------gagttct---tccatgtagagga-cctagaaggcggcatcaga
                                ******    * ****   *** *  ** ** **  *   **

A0A8C3W949_MCL1-01      cttctgtggctgggcagagtgagaattcaaccagatggaagaaatcccag
A0A8C3W949_MCL1-02      aatgtgctgctggcttttgcaggtgtt------gctggag----------
A0A8C3W949_MCL1-03      aatgtgctgctggcttttgcaggtgtt------gctggag----------
                          * **  *****     *   *  **      * ****           

A0A8C3W949_MCL1-01      ggacttagacttaggtactttcctgaggctttctacttcctgtaa-----
A0A8C3W949_MCL1-02      -----------taggagct-------ggtttggcatatctaataagatag
A0A8C3W949_MCL1-03      -----------taggagct-------ggtttggcatatctaataagatag
                                   ****  **       ** **   *  **   ***     

© 1998-2022Legal notice