Dataset for CDS MCL-1 of organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W6CDF4_MCL1-03      atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttat
A0A4W6CDF4_MCL1-01      atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttat
A0A4W6CDF4_MCL1-02      atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttat

A0A4W6CDF4_MCL1-03      tcttcctcaaaatggagtcgcggagggactgcactacagctcaggagatt
A0A4W6CDF4_MCL1-01      tcttcctcaaaatggagtcgcggagggactgcactacagctcaggagatt
A0A4W6CDF4_MCL1-02      tcttcctcaaaatggagtcgcggagggactgcactacagctcaggagatt

A0A4W6CDF4_MCL1-03      cctcaccacagatcgccatgggctcaactatagactctcgcaacgggaat
A0A4W6CDF4_MCL1-01      cctcaccacagatcgccatgggctcaactatagactctcgcaacgggaat
A0A4W6CDF4_MCL1-02      cctcaccacagatcgccatgggctcaactatagactctcgcaacgggaat

A0A4W6CDF4_MCL1-03      gttgggtccccaaagcggcccaagaacttggaagtcagctcaacaaatgg
A0A4W6CDF4_MCL1-01      gttgggtccccaaagcggcccaagaacttggaagtcagctcaacaaatgg
A0A4W6CDF4_MCL1-02      gttgggtccccaaagcggcccaagaacttggaagtcagctcaacaaatgg

A0A4W6CDF4_MCL1-03      gtatccagcaaaaagccgtcttgaggacagcgacgtcgacgacggctctt
A0A4W6CDF4_MCL1-01      gtatccagcaaaaagccgtcttgaggacagcgacgtcgacgacggctctt
A0A4W6CDF4_MCL1-02      gtatccagcaaaaagccgtcttgaggacagcgacgtcgacgacggctctt

A0A4W6CDF4_MCL1-03      tgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagt
A0A4W6CDF4_MCL1-01      tgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagt
A0A4W6CDF4_MCL1-02      tgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagt

A0A4W6CDF4_MCL1-03      tgtccagcaggggacgaagtgttggagaatgataccaggcaactgattag
A0A4W6CDF4_MCL1-01      tgtccagcaggggacgaagtgttggagaatgataccaggcaactgattag
A0A4W6CDF4_MCL1-02      tgtccagcaggggacgaagtgttggagaatgataccaggcaactgattag

A0A4W6CDF4_MCL1-03      ccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
A0A4W6CDF4_MCL1-01      ccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
A0A4W6CDF4_MCL1-02      ccagttcatgagagactttactggactttcgaaaccacggtggaataaaa

A0A4W6CDF4_MCL1-03      gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaa
A0A4W6CDF4_MCL1-01      gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaa
A0A4W6CDF4_MCL1-02      gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaa

A0A4W6CDF4_MCL1-03      cacagatacgcatacaacggtatgatcaacaaactgtcgttggatgacag
A0A4W6CDF4_MCL1-01      cacagatacgcatacaacggtatgatcaacaaactgtcgttggatgacag
A0A4W6CDF4_MCL1-02      cacagatacgcatacaacggtatgatcaacaaactgtcgttggatgacag

A0A4W6CDF4_MCL1-03      aggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggag
A0A4W6CDF4_MCL1-01      aggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggag
A0A4W6CDF4_MCL1-02      aggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggag

A0A4W6CDF4_MCL1-03      acggcaccacaaactggggtcgtattgccagcctggtggccttcggcgca
A0A4W6CDF4_MCL1-01      acggcaccacaaactggggtcgtattgccagcctggtggccttcggcgca
A0A4W6CDF4_MCL1-02      acggcaccacaaactggggtcgtattgccagcctggtggccttcggcgca

A0A4W6CDF4_MCL1-03      gtggtgtgtcagcacctaaaggagaggggcagggtggactgtgtggatct
A0A4W6CDF4_MCL1-01      gtggtgtgtcagcacctaaaggagaggggcagggtggactgtgtggatct
A0A4W6CDF4_MCL1-02      gtggtgtgtcagcacctaaaggagaggggcagggtggactgtgtggatct

A0A4W6CDF4_MCL1-03      tgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggc
A0A4W6CDF4_MCL1-01      tgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggc
A0A4W6CDF4_MCL1-02      tgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggc

A0A4W6CDF4_MCL1-03      ttgtgaaaaacaactcctgggatggctttgtggagttctttcacgtatca
A0A4W6CDF4_MCL1-01      ttgtgaaaaacaactcctgggatggctttgtggagttctttcacgtatca
A0A4W6CDF4_MCL1-02      ttgtgaaaaacaactcctgggatggctttgtggagttctttcacgtatca

A0A4W6CDF4_MCL1-03      gacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
A0A4W6CDF4_MCL1-01      gacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
A0A4W6CDF4_MCL1-02      gacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc

A0A4W6CDF4_MCL1-03      tggtatcggggccacactggctttgttgatcagcaattacccagcagcaa
A0A4W6CDF4_MCL1-01      tggtatcggggccacactggctttgttgatcaggtctttct---------
A0A4W6CDF4_MCL1-02      tggtatcggggccacactggctttgttgatcagatcctccc---------
                        *********************************    * *          

A0A4W6CDF4_MCL1-03      gagtgtttgtat-gcaaggccaaggcaggaagggagagctgcatttttcc
A0A4W6CDF4_MCL1-01      gtgaatttgggt--cagggc----------------------------tg
A0A4W6CDF4_MCL1-02      gttgtcttgggttacaggacaaacaca-------------acactcatcg
                        *     ***  *  ** * *                              

A0A4W6CDF4_MCL1-03      atgtctt-----gcagtcatgaagcccatttccatagagcccattgacaa
A0A4W6CDF4_MCL1-01      aagtctt--------------tcatcctcccccatgga------------
A0A4W6CDF4_MCL1-02      aggtcttaggaggaaatggagtagagcctctccatgg-------------
                        * *****                   *    **** *             

A0A4W6CDF4_MCL1-03      gcctcggatcatttgtatggattcaactttgtga
A0A4W6CDF4_MCL1-01      -------------------------------tga
A0A4W6CDF4_MCL1-02      -------------------------------tga

© 1998-2023Legal notice