Dataset for CDS MCL-1 of organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=978 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagcaattacccagcagcaagagtgtttgtatgcaaggccaaggcaggaa
gggagagctgcatttttccatgtcttgcagtcatgaagcccatttccatagagcccattgacaagcctcggatcatttgt
atggattcaactttgtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=888 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcaggtctttctgtgaatttgggtcagggctgaagtctttcatcctccccc
atggatga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=918 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagatcctcccgttgtcttgggttacaggacaaacacaacactcatcgag
gtcttaggaggaaatggagtagagcctctccatggtga
© 1998-2020Legal notice