Dataset for CDS MCL-1 of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671L9M9_MCL1-01      atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgc--
A0A671RQ00_MCL1-01      atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgc--
A0A671LAP7_MCL1-01      atg-actctgagtttggggaatagaccgatggctgcgttgggtgtcct--
A0A671LEY4_MCL1-01      atg-actctgagtttagtcagaaga---acggctgcggtgagtctgctcg
                        ***  * *** *  *         *   *     **  *  *        

A0A671L9M9_MCL1-01      --------------------------attggaatagcagctcttaacgtc
A0A671RQ00_MCL1-01      --------------------------attggaataacagctcttaacgtc
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A671LEY4_MCL1-01      gcgcgcacacggcgctcgtgcccgcggccgcactcaaagcgcggagcgag
                                                                          

A0A671L9M9_MCL1-01      aac--------------aacagctcgagcgggtttagtcgc----aagcc
A0A671RQ00_MCL1-01      aac--------------agcagctcgggcgggcttggtcgc----aagcc
A0A671LAP7_MCL1-01      -----------------cgcggaggaagcggac---gccgcgctgaagcc
A0A671LEY4_MCL1-01      gacgagctcgacgggtgcgcggatgaaccggac---gccgcggggaagcc
                                           * *      ***     * ***    *****

A0A671L9M9_MCL1-01      acttgtaatgccagaactgaaagcccagaaccagttcacag-ggaacggt
A0A671RQ00_MCL1-01      actggtaatgccagaacggaaaccccagaaccagtttacag-ggaacgga
A0A671LAP7_MCL1-01      ---gctgaggcccgggaccaacggcctgaa-aggcctgcagctggacgga
A0A671LEY4_MCL1-01      ---ggtaagaccgggagcgaacggcctgag-aggactacagctggacgga
                             * *  ** *     **   ** **    *    ***  * **** 

A0A671L9M9_MCL1-01      c--------tcc-------aaggctcggtaccatcctcgcctgagacgga
A0A671RQ00_MCL1-01      c--------tcc-------agggctcggtaccatcctcgcctaaaccgga
A0A671LAP7_MCL1-01      cggttcgtgtccgcgggagacggctctctaccggccaccccggacccg--
A0A671LEY4_MCL1-01      cgcttcgtttccgcggcggacggatctctaccgagcacaccggacccg--
                        *        ***       * ** **  ****   * * **  *  **  

A0A671L9M9_MCL1-01      ctgcgaggaaat---agatgattacacctccatctacgccgccctggaaa
A0A671RQ00_MCL1-01      ttgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaa
A0A671LAP7_MCL1-01      ----caggagct------------------cggttc--------------
A0A671LEY4_MCL1-01      ----caggagct------------------cggttccgccgaactggacc
                             ****  *                  *   *               

A0A671L9M9_MCL1-01      tggacacgcgagagattattgacgctttcttaaaaagctttacaggactc
A0A671RQ00_MCL1-01      tggacacacgagagattattgacattttcttaaagaactttactggattc
A0A671LAP7_MCL1-01      -cgacacgcggcagcttctgttggatttctatcgcacgcacaccggaatg
A0A671LEY4_MCL1-01      gcgacacgagacagcttttgttggatttctaccgcacgcacaccggaatg
                          *****  *  ** ** *      *****     *     ** *** * 

A0A671L9M9_MCL1-01      tctcattataaaagtggaaaaaaacaggttctgtctacgatgaagggggt
A0A671RQ00_MCL1-01      cctcattctaaaagtgggaataaacaggttctggcaacgatgaatcgggt
A0A671LAP7_MCL1-01      agtctcccggaccggaagcgtcatcacgcgttaccgacaatgaaacgcgt
A0A671LEY4_MCL1-01      tgtccacaggaccggaagcagcaccacgcgttaccgacaatgactcaagt
                          **      *  *        * ** *   *  * ** ****     **

A0A671L9M9_MCL1-01      tgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattg
A0A671RQ00_MCL1-01      tgtggaaagtcttgtgatgaagcacgaactggtttacaaaggtatgattg
A0A671LAP7_MCL1-01      cgtcgcggacgtcgtcataaagcaccagatcacttacagagggatgctgc
A0A671LEY4_MCL1-01      tgtcgcggacattctcctaaagcacgagatcgcatacaaaggaatgttgc
                         ** *      *     * ****** *  *    **** *** *** *  

A0A671L9M9_MCL1-01      cacggctgaatctggagcagaaaggagaagatgtgaggtttgtcaagact
A0A671RQ00_MCL1-01      cacgtctgaatctggagcagaaaggagaagatgtgagtttcgtcaagact
A0A671LAP7_MCL1-01      agcatctgcagctggactctcagccggacgacttgagcttcatcggctgt
A0A671LEY4_MCL1-01      agcgtctgcagctggaatctcaagcggacgacatgagcttcatcagctgt
                          *  *** * *****     *    ** **  **** **  **     *

A0A671L9M9_MCL1-01      gtggcaacagaactcttcagcgatggcatcacaaactgggggcgcatttg
A0A671RQ00_MCL1-01      gtggcaacggaactcttcagcgatggcatcacaaactggggtcgcattgc
A0A671LAP7_MCL1-01      atagcaaagacgatgttcagagacgacaccaccaactggggccggatcgt
A0A671LEY4_MCL1-01      atagcagagacgatgttcaacgacaacaccaccaactggggccggatcgt
                         * ***       * ****  **   ** *** ******** ** **   

A0A671L9M9_MCL1-01      cagcctgctgacttttggggcaatggtatgcaagcatcaaaatg------
A0A671RQ00_MCL1-01      cagcctgcttacttttggggcaatggtatctaagcatcagaatg------
A0A671LAP7_MCL1-01      gagtctggtggccttcggggccgtggtgtgctcgcgtctgaaggagctgc
A0A671LEY4_MCL1-01      gagtctggtggccttcggggccgtggtgtgctcgcgtctgaaggagctgc
                         ** *** *  * ** *****  **** *    ** **  ** *      

A0A671L9M9_MCL1-01      atagaggacttggcaagtgtgtgagtctggtgggggaagagatctcttcc
A0A671RQ00_MCL1-01      ataaaggacttagcaagtgtgtgagtctggtggggaaagagatctcttcc
A0A671LAP7_MCL1-01      agagagagc------ggtgcgtggagactgtggcccagcagatctcctcc
A0A671LEY4_MCL1-01      agagagagc------ggtgcgtggagacggtggcccagcagatctcctcc
                        * * **  *       *** ***      ****   *  ******* ***

A0A671L9M9_MCL1-01      tatcttctcacagaccaacgggactggctgctcaaaaacaaagcatggga
A0A671RQ00_MCL1-01      tatcttctcacaacccagcgggactggctgctcaaaaacaaagcatggga
A0A671LAP7_MCL1-01      tatctgatctcagaacagcacgactggctgctcaacaacaagggctggca
A0A671LEY4_MCL1-01      tatctgatctcagaacagcacgactggctgctcaacaacaagggctggca
                        *****  ** **   ** *  ************** ***** *  *** *

A0A671L9M9_MCL1-01      tggctttgtggaattttttcatgtcccggatacagaggcagctatgagaa
A0A671RQ00_MCL1-01      tggctttgtggaattttttcatgtcccaaatacagaagcggctgtgagaa
A0A671LAP7_MCL1-01      tgggttcgtggagttcttccgcgtggaggacgtggagtctgtggttcgca
A0A671LEY4_MCL1-01      tggattcgtggagtttttctgcgttgaggatgtggagtctgtgattcgta
                        *** ** ***** ** **    **     *    **  * *   *  * *

A0A671L9M9_MCL1-01      gcacattgatggtcattggtggtgtggcaacattcggagctgctcttgct
A0A671RQ00_MCL1-01      acacattgatggccattggtagtgtggctacattcggagctgcacttgct
A0A671LAP7_MCL1-01      gcgctctgatggcggttgtgggatgtgctgggatcggcgccggtctcgct
A0A671LEY4_MCL1-01      atgctttgatggctgtggtgggatgcgctgggatcggcgccggtct---t
                           *  ******   * *   *    **     **** ** *  **   *

A0A671L9M9_MCL1-01      tatttga--------tacgg----tga
A0A671RQ00_MCL1-01      tatttga--------cacgg----tga
A0A671LAP7_MCL1-01      ctcctga--------tccga----tga
A0A671LEY4_MCL1-01      ctctttaaaaataattgtgaagtctga
                            * *           *     ***

© 1998-2020Legal notice