Dataset for CDS BCL-2 of organism Varanus komodoensis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=1050 residues).
atgctgttcgcagagatgtccggggcgctgctgctggcggcggccgccggggtcgccctcctcgtggccttcctgctgtt
gctgtatctggtgtcgccggtgacaagccccaagccactgtccttgtccggcgcccacgtcgtggtaactggtggctcca
gtggcattgggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatgagaaccgt
ctgatggaaacaaaaaaagaaattgagaaattctctgttaatgataagcaggttgtacagtccatttctgtggatgtttc
caaggatggtacaaatgtggcaagggttctaaaacaggctcaagagaagttgggtccagttgacatgctcataaattgtg
ctggaacatcagttaatgcaaaatttgaagatcttgacatcagtaagtttgagcaactgatggctatcaactacttgggg
agcatttacccaactcgtgcagtagttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcccaggc
tgggcaggttggagtatttggctacacagcttattctgcaacaaagtttgcacttcgaggactagctgaagctttgcaga
tggaggtaaagccctacaatatctacataacagttgcgtatcctccagatacagacacccctggctatgcagaagaaaat
aagcataaggttttagagaccaagcttatttcagaagcatcatcaatctgccaacctgattatgttgctagaatcattgt
aaaagatgcaattcaaggaaaattcagcagttctattggtacggatggtcacatgttgacagtattgaccagtgggatgt
caccagtttcttctattgctgaagtcctagaggcggatgcctttgtggagctgtacagcaacaacatgaggcctttgttt
gacttttcctggctgcctctgaaaacaatcctgagcctggcggtcgtgggcgcgtgcatcaccctcggtgcttacctggg
ccacaagtga
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=711 residues).
atgatggctcatcctgggataagagcttatgataatagggagattgtgctgaggtacatccgttacaaactctcacagaa
aggatatgactgggtggctggtggagacccagaaaaccttcctgctcctgctcctgctcctgctcctgctgggagcatcc
ctgcccttgctgggctggcatccctgccttctgagctgcctgactctgctgctgtgaggaatgttgcccctgctgacgaa
ctacacccagtgccagcgccacaggttgtccattcaactttacgccaagctggagatgagttttcacggctttaccggag
ggattttgctcagatgtctggccagttgcacttgactccagtcactgccagaagccgtttcgtggctgtggtggaagagc
tgttccgtgatgggatcaattggggcaggattgtagcgttctttgaattcggtggcatgctgagcgtggagagtgtcagt
cgggagatgtcaccccttgtggacaatatcactgtgtggatgactgagtacctgaacaggcacctgcacaactggatcca
ggacaatggaggctgggatgcctttgtggagctgtacagcaacaacatgaggcctttgtttgacttttcctggctgcctc
tgaaaacaatcctgagcctggcggtcgtgggcgcgtgcatcaccctcggtgcttacctgggccacaagtga
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=1026 residues).
atgctgttcgcagagatgtccggggcgctgctgctggcggcggccgccggggtcgccctcctcgtggccttcctgctgtt
gctgtatctggtgtcgccggtgacaagccccaagccactgtccttgtccggcgcccacgtcgtggtaactggtggctcca
gtggcattgggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatgagaaccgt
ctgatggaaacaaaaaaagaaattgagaaattctctgttaatgataagcaggttgtacagtccatttctgtggatgtttc
caaggatggtacaaatgtggcaagggttctaaaacaggctcaagagaagttgggtccagttgacatgctcataaattgtg
ctggaacatcagttaatgcaaaatttgaagatcttgacatcagtaagtttgagcaactgatggctatcaactacttgggg
agcatttacccaactcgtgcagtagttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcccaggc
tgggcaggttggagtatttggctacacagcttattctgcaacaaagtttgcacttcgaggactagctgaagctttgcaga
tggaggtaaagccctacaatatctacataacagttgcgtatcctccagatacagacacccctggctatgcagaagaaaat
aagcataaggttttagagaccaagcttatttcagaagcatcatcaatctgccaacctgattatgttgctagaatcattgt
aaaagatgcaattcaaggaaaattcagcagttctattggtacggatggtcacatgttgacagtattgaccagtgggatgt
caccagtttcttctattgctgaagtcctagaggcggttatttgcatgggtatttttcgtttcgttagtctttattttata
gcaggttttgacagcatagttcgtcgttgcatggtacaaagagaaaagtctgaaaagactgactga
© 1998-2023Legal notice