Dataset for CDS Unclassified of organism Prolemur simus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C8ZSD6_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Prolemur simus (length=240 residues).
atggagccactggtgggacaagtgcaggaatggatggtgacctacctggagacacggctggccgactggatccacagcag
tgggggctgggcgcagttcacagctctccatggagatggggccctggaggaggcacggcgtcaaagagagaaaaactggg
catcagtgagaacagtgctgacaggggccgtggcactggggaccctgttaactataggaaccttctttgctaacaagtaa
>gnl|bcl2dbcds|A0A8C9AL63_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Prolemur simus (length=240 residues).
atagagccactagtgggacaagtgcaagagtggatggtggcctacctggagacacggctggctgactggatccacagcag
tgggggctgggcagagttcacggctctatatgggaacggggccctagaggaagcacagcgtcaaagggagggaaactgga
catcagtgagaacagtgctgatgggggccgtgacaccggggaccctgttaactatagggggcttcttcactagcaagtga
© 1998-2023Legal notice