Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5PK00_BCL2A1-      atgaccgactgtgagtttggatatattcacatgctggcccaggactacct
A0A5F5PK00_BCL2A1-      atgaccgactgtgagtttggatatattcacatgctggcccaggactacct
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      atgtc----------------tcagagcaa----------ccgggagctg
A0A3Q2H0F6_BCL2L1-      atgtc----------------tcagagcaa----------ccgggagctg
A0A5F5PML6_BCL2L2-      atggcggcggcggcggcggcggcagcagca----------gcgggggct-
A0A5F5PML6_BCL2L2-      atggcgaccccagcctcagccccagacaca-----------cgggctcta
A0A5F5PML6_BCL2L2-      atggcgaccccagcctcagccccagacaca-----------cgggctcta
A0A3Q2HRY3_BCL2-01      atggcgcacgctg--------ggagaacagggtatgataaccgggagata
A0A3Q2HRY3_BCL2-02      atggcgcacgctg--------ggagaacagggtatgataaccgggagata
F6ZPD4_BCL2L10-01       -------gccgtg--------gcggaggcg----------ctgagggagc
A0A5F5Q151_MCL1-01      atgtttggcctga--------aaagaaacg----------c--agtaatc
A0A5F5Q151_MCL1-02      atgtttggcctga--------aaagaaacg----------c--agtaatc
                                                                          

A0A5F5PK00_BCL2A1-      gaagtacgtcctgcagataccacaacctgg--------------------
A0A5F5PK00_BCL2A1-      gaagtacgtcctgcagataccacaacctgg--------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      gtggttgactttctctc--ctacaagctttcccagaaaggatacaactg-
A0A3Q2H0F6_BCL2L1-      gtggttgactttctctc--ctacaagctttcccagaaaggatacaactg-
A0A5F5PML6_BCL2L2-      ---gcgggcggtcgggg--ctccgggccggggcggcggcgccat-cttgt
A0A5F5PML6_BCL2L2-      gtggcagactttgtagg--ctataagctgaggcagaagggttatgtttgt
A0A5F5PML6_BCL2L2-      gtggcagactttgtagg--ctataagctgaggcagaagggttatgtttgt
A0A3Q2HRY3_BCL2-01      gtgatgaagtacatcca--ctataagctgtcgcagaggggctac------
A0A3Q2HRY3_BCL2-02      gtgatgaagtacatcca--ctataagctgtcgcagaggggctac------
F6ZPD4_BCL2L10-01       gcacggcgctactgctgatcgactacctgcagcgccgcgcccgg------
A0A5F5Q151_MCL1-01      ggactcaacctctactg----------tgggggggccgggttgg------
A0A5F5Q151_MCL1-02      ggactcaacctctactg----------tgggggggccgggttgg------
                                                                          

A0A5F5PK00_BCL2A1-      -------------atctggtccaagcaaaacatccagagtgttacaagac
A0A5F5PK00_BCL2A1-      -------------atctggtccaagcaaaacatccagagtgttacaagac
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      -----------------gagtcagtttagtgacgt--ggaagagaacaga
A0A3Q2H0F6_BCL2L1-      -----------------gagtcagtttagtgacgt--ggaagagaacaga
A0A5F5PML6_BCL2L2-      gcccggggccggtggggaggccggggagggggccccggggggcgcagggg
A0A5F5PML6_BCL2L2-      ggagctggccccggggagggcccagccgctgaccc-----actgcaccaa
A0A5F5PML6_BCL2L2-      ggagctggccccggggagggcccagccgctgaccc-----actgcaccaa
A0A3Q2HRY3_BCL2-01      -------------gagtggg--atgccggagacgc-----------gggc
A0A3Q2HRY3_BCL2-02      -------------gagtggg--atgccggagacgc-----------gggc
F6ZPD4_BCL2L10-01       -------------gagccggccacgcccgaggtgg-----------ccgt
A0A5F5Q151_MCL1-01      -------------gggccggc---------ggcgg-----------cggc
A0A5F5Q151_MCL1-02      -------------gggccggc---------ggcgg-----------cggc
                                                                          

A0A5F5PK00_BCL2A1-      attgctttctcagttcaaaatgaagtaga---------------------
A0A5F5PK00_BCL2A1-      attgctttctcagttcaaaatgaagtaga---------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      actgaggccccagaagggactgaatcaga---------------------
A0A3Q2H0F6_BCL2L1-      actgaggccccagaagggactgaatcaga---------------------
A0A5F5PML6_BCL2L2-      actacgggaacggcctg----gagtctgaggaactggagcctgaggagct
A0A5F5PML6_BCL2L2-      gccatgcgggcagctggagatgagtttga-gacccgcttccggcgcacct
A0A5F5PML6_BCL2L2-      gccatgcgggcagctggagatgagtttga-gacccgcttccggcgcacct
A0A3Q2HRY3_BCL2-01      gccgcgcccctg--------------------------------------
A0A3Q2HRY3_BCL2-02      gccgcgcccctg--------------------------------------
F6ZPD4_BCL2L10-01       gctgcgctgc----------------------------------------
A0A5F5Q151_MCL1-01      gcctcgtcgccgg-------------------------------------
A0A5F5Q151_MCL1-02      gcctcgtcgccgg-------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      -------gatggagacc---------------------------------
A0A3Q2H0F6_BCL2L1-      -------gatggagacc---------------------------------
A0A5F5PML6_BCL2L2-      gct----gctggagcccgag------------------------------
A0A5F5PML6_BCL2L2-      tctctgatctggcggctcag------------------------------
A0A5F5PML6_BCL2L2-      tctctgatctggcggctcag------------------------------
A0A3Q2HRY3_BCL2-01      -----------ggggccacc------------------------------
A0A3Q2HRY3_BCL2-02      -----------ggggccacc------------------------------
F6ZPD4_BCL2L10-01       -----------gtggccgcc------------------------------
A0A5F5Q151_MCL1-01      -------gagggcggcttttggctgcggggaaggaggccacggcccggcg
A0A5F5Q151_MCL1-02      -------gagggcggctttt------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      agagggagggggaggggaggccggcgcggtgattggcggaagcgccggcg
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      ggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccc
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      ---------gaagaatttgaaaccatgcttggacaattttcatgtt----
A0A5F5PK00_BCL2A1-      ---------gaagaatttgaaaccatgcttggacaattttcatgtt----
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ---------------------cccagtgcca--tcaatggcaaccc----
A0A3Q2H0F6_BCL2L1-      ---------------------cccagtgcca--tcaatggcaaccc----
A0A5F5PML6_BCL2L2-      ----------ccg-----gagcccg-----agcccgaagaggagcc----
A0A5F5PML6_BCL2L2-      ----------ctgcatgtgaccccgggctcagcccagcaacgcttc----
A0A5F5PML6_BCL2L2-      ----------ctgcatgtgaccccgggctcagcccagcaacgcttc----
A0A3Q2HRY3_BCL2-01      ---------------------cccgtgccgggcatcttctcctcccagcc
A0A3Q2HRY3_BCL2-02      ---------------------cccgtgccgggcatcttctcctcccagcc
F6ZPD4_BCL2L10-01       -----------cagatacagccccgcaaccagcgtgttctttccc-----
A0A5F5Q151_MCL1-01      tcccccattggcgccgagggccccgacgtcaccgcgccctcctccaggct
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      ----------------------------------------------gtgt
A0A5F5PK00_BCL2A1-      ----------------------------------------------gtgt
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      -------------------------------------------------a
A0A3Q2H0F6_BCL2L1-      -------------------------------------------------a
A0A5F5PML6_BCL2L2-      -------------------------------------------------g
A0A5F5PML6_BCL2L2-      -------------------------------------------------a
A0A5F5PML6_BCL2L2-      -------------------------------------------------a
A0A3Q2HRY3_BCL2-01      cgggcgc------------------------------------------a
A0A3Q2HRY3_BCL2-02      cgggcgc------------------------------------------a
F6ZPD4_BCL2L10-01       ----------------------------------------------gcta
A0A5F5Q151_MCL1-01      gctgttcttcgcgcccacccgctgcgcgtcgccgcctgaggggatggaag
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      ccatagatgctgccagaacaatattc------------------------
A0A5F5PK00_BCL2A1-      ccatagatgctgccagaacaatattc------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      tcctggcacctggcggacagccccac------------------------
A0A3Q2H0F6_BCL2L1-      tcctggcacctggcggacagccccac------------------------
A0A5F5PML6_BCL2L2-      ccccggcccc------gcgccccccc------------------------
A0A5F5PML6_BCL2L2-      cccaggtctctgacgaactcttccaa------------------------
A0A5F5PML6_BCL2L2-      cccaggtctctgacgaactcttccaa------------------------
A0A3Q2HRY3_BCL2-01      cccccgcgcccgccaggacctccccg------------------------
A0A3Q2HRY3_BCL2-02      cccccgcgcccgccaggacctccccg------------------------
F6ZPD4_BCL2L10-01       ccgcggcttccgcggggaccacgtcg------------------------
A0A5F5Q151_MCL1-01      ccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtac
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      gagccggagcctctcgggaagcggccggctgtcctgcccttgctggagtt
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      tgtccgggaggccagcagtggcccctgcacggacggctcgctcccctcga
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ---g----------------------------------------------
A0A3Q2H0F6_BCL2L1-      ---g----------------------------------------------
A0A5F5PML6_BCL2L2-      ---gggagctccgg--------gccctg-ggcc-----tggctcgggagc
A0A5F5PML6_BCL2L2-      ---ggtggccccaactggggccgccttgtggccttctttgtctttggagc
A0A5F5PML6_BCL2L2-      ---ggtggccccaactggggccgccttgtggccttctttgtctttggagc
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      cgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctg
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      ---aatcaagtgatggaaaagcaatttgaagatggcatcattaactgggg
A0A5F5PK00_BCL2A1-      ---aatcaagtgatggaaaagcaatttgaagatggcatcattaactgggg
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      ------------atggaaaagcaatttgaagatggcatcattaactgggg
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ---------------------------gggaatggagccactg--gccac
A0A3Q2H0F6_BCL2L1-      ---------------------------gggaatggagccactg--gccac
A0A5F5PML6_BCL2L2-      --ccccggcagccaggag-------gaggaggaggagcc------gggac
A0A5F5PML6_BCL2L2-      cgcgctgtgtgctgagagtgtcaacaaggagatggagccacttgtgggac
A0A5F5PML6_BCL2L2-      cgcgctgtgtgctgagagtgtcaacaaggagatggagccacttgtgggac
A0A3Q2HRY3_BCL2-01      ------------------ctgctacccccggccgcccccgccggcgccgc
A0A3Q2HRY3_BCL2-02      ------------------ctgctacccccggccgcccccgccggcgccgc
F6ZPD4_BCL2L10-01       -----------------------------ggctggcggcacggatggcgc
A0A5F5Q151_MCL1-01      gagattatctctcgttaccttcgggaacaggctaccggcaccaaggacac
A0A5F5Q151_MCL1-02      -----------------------------ggctaccggcaccaaggacac
                                                                          

A0A5F5PK00_BCL2A1-      aagaatta-------------------tgaccatatttgcatttgaaggt
A0A5F5PK00_BCL2A1-      aagaatta-------------------tgaccatatttgcatttgaaggt
A0A5F5PK00_BCL2A1-      -------a-------------------tggcggcggcagctgtgagtggt
A0A5F5PK00_BCL2A1-      aagaatta-------------------tgaccatatttgcatttgaaggt
A0A5F5PK00_BCL2A1-      -------a-------------------tgacc------------gactgt
A0A3Q2H0F6_BCL2L1-      agcagcag-----------------cttggatgcccgg----------ga
A0A3Q2H0F6_BCL2L1-      agcagcag-----------------cttggatgcccgg----------ga
A0A5F5PML6_BCL2L2-      tggtcgag--------------------ggtgacccgg----------gg
A0A5F5PML6_BCL2L2-      aagtgcaggagtggatggtggcctacctggagactcggctggccgactgg
A0A5F5PML6_BCL2L2-      aagtgcaggagtggatggtggcctacctggagactcggctggccgactgg
A0A3Q2HRY3_BCL2-01      gggacctg---------------ccctcag--------------------
A0A3Q2HRY3_BCL2-02      gggacctg---------------ccctcag--------------------
F6ZPD4_BCL2L10-01       --aggcga---------------tcttcggagaccgcc----------ac
A0A5F5Q151_MCL1-01      gaagccaa---------------tgggcgg--------------------
A0A5F5Q151_MCL1-02      gaagccaa---------------tgggcgg--------------------
                                                                          

A0A5F5PK00_BCL2A1-      attctcatcaagaaacttctacc------agagcgaattgccccagatgt
A0A5F5PK00_BCL2A1-      attctcatcaagaaacttctacc------agagcgaattgccccagatgt
A0A5F5PK00_BCL2A1-      gct------aagcggcgcctg-c------gggccgagctg----------
A0A5F5PK00_BCL2A1-      attctcatcaagaaacttctacc------agagcgaattgccccagatgt
A0A5F5PK00_BCL2A1-      attctcatcaagaaacttctacc------agagcgaattgccccagatgt
A0A3Q2H0F6_BCL2L1-      agtgatccccatggcagc-----------agtgaagcaagcgc---tgag
A0A3Q2H0F6_BCL2L1-      agtgatccccatggcagc-----------agtgaagcaagcgc---tgag
A0A5F5PML6_BCL2L2-      gacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcag
A0A5F5PML6_BCL2L2-      atccacagcagtggaggctgggagctggaagcgatcaaagctcgagtcag
A0A5F5PML6_BCL2L2-      atccacagcagtggaggctgggagctggaagcgatcaaagctcgagtcag
A0A3Q2HRY3_BCL2-01      -------ccctgtgccacctg--t-----ggtccacctgaccc---tgcg
A0A3Q2HRY3_BCL2-02      -------ccctgtgccacctg--t-----ggtccacctgaccc---tgcg
F6ZPD4_BCL2L10-01       gtccccagctggggccgcgtg--gc----ggcgctcgtgaccc---t---
A0A5F5Q151_MCL1-01      ------gtctggggccgccag--ccggaaggcgttagagaccc---tgcg
A0A5F5Q151_MCL1-02      ------gtctggggccgccag--ccggaaggcgttagagaccc---tgcg
                                                      *                   

A0A5F5PK00_BCL2A1-      ggatacttacaaggagattt-----cttactttgttgctgagttcataac
A0A5F5PK00_BCL2A1-      ggatacttacaaggagattt-----cttactttgttgctgagttcataac
A0A5F5PK00_BCL2A1-      ----------aagcagcgt------------------ctgcg-----ggc
A0A5F5PK00_BCL2A1-      ggatacttacaaggagattt-----cttactttgttgctgagttcataac
A0A5F5PK00_BCL2A1-      ggatacttacaaggagattt-----cttactttgttgctgagttcataac
A0A3Q2H0F6_BCL2L1-      ggaggcaggcgatgagtttg-------aactgaggtaccg-------gcg
A0A3Q2H0F6_BCL2L1-      ggaggcaggcgatgagtttg-------aactgaggtaccg-------gcg
A0A5F5PML6_BCL2L2-      ggagatggaggaagaggctgagaagctaaaagagctacag-------aac
A0A5F5PML6_BCL2L2-      ggagatggaggaagaggctgagaagctaaaagagctacag-------aac
A0A5F5PML6_BCL2L2-      ggagatggaggaagaggctgagaagctaaaagagctacag-------aac
A0A3Q2HRY3_BCL2-01      ccaggccggcgatgacttct----cccgtcgctaccgccgcgactttgcc
A0A3Q2HRY3_BCL2-02      ccaggccggcgatgacttct----cccgtcgctaccgccgcgactttgcc
F6ZPD4_BCL2L10-01       ----ggcggggacg--------------------ctgctg----------
A0A5F5Q151_MCL1-01      gcgggtcggggacgg------------------agtgcagcg-caatcac
A0A5F5Q151_MCL1-02      gcgggtcggggacgg------------------agtgcagcg-caatcac
                                   *                         * *          

A0A5F5PK00_BCL2A1-      gaaaaacacaggagaatggataa---------------------------
A0A5F5PK00_BCL2A1-      gaaaaacacaggagaatggataa---------------------------
A0A5F5PK00_BCL2A1-      gatgagcgccgaggaacggctac---------------------------
A0A5F5PK00_BCL2A1-      gaaaaacacaggagaatggataa---------------------------
A0A5F5PK00_BCL2A1-      gaaaaacacaggagaatggataa---------------------------
A0A3Q2H0F6_BCL2L1-      ggcatt---cagcgacctgacat---cccagctccacatcac-----ccc
A0A3Q2H0F6_BCL2L1-      ggcatt---cagcgacctgacat---cccagctccacatcac-----ccc
A0A5F5PML6_BCL2L2-      gaggttgagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A5F5PML6_BCL2L2-      gaggttgagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A5F5PML6_BCL2L2-      gaggttgagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A3Q2HRY3_BCL2-01      gagatgtccagccag------ctgcacctgacgcctttcacc----gcaa
A0A3Q2HRY3_BCL2-02      gagatgtccagccag------ctgcacctgacgcctttcacc----gcaa
F6ZPD4_BCL2L10-01       gagagagccccgcgg---ggaacctaccgaaagccg--------------
A0A5F5Q151_MCL1-01      gagacggccttccaa---ggcatgcttcggaaactggacatc----aaaa
A0A5F5Q151_MCL1-02      gagacggccttccaa---ggcatgcttcggaaactggacatc----aaaa
                        *                                                 

A0A5F5PK00_BCL2A1-      ---ggcaaaatggaggct---------gggtgattgcccacagtcagtat
A0A5F5PK00_BCL2A1-      ---ggcaaaatggaggct---------gggaaaatggctttgtaaagaag
A0A5F5PK00_BCL2A1-      ---gccagtctcgcctcttgactcagaaggtgattgcccacagtcagtat
A0A5F5PK00_BCL2A1-      ---ggcaaaatggaggct---------gggtgattgcccacagtcagtat
A0A5F5PK00_BCL2A1-      ---ggcaaaatggaggct---------gggtgattgcccacagtcagtat
A0A3Q2H0F6_BCL2L1-      agggacagcatatcagagctttgagc-aggtagtgaa-------------
A0A3Q2H0F6_BCL2L1-      agggacagcatatcagagctttgagc-aggtagtgaa-------------
A0A5F5PML6_BCL2L2-      agtgat--catgtc----cattgagg-agaagatggaggctgatgctcgt
A0A5F5PML6_BCL2L2-      agtgat--catgtc----cattgagg-agaagatggaggctgatgctcgt
A0A5F5PML6_BCL2L2-      agtgat--catgtc----cattgagg-agaagatggaggctgatgctcgt
A0A3Q2HRY3_BCL2-01      ggggacgctttgcca------------cggtagtgga-------------
A0A3Q2HRY3_BCL2-02      ggggacgctttgcca------------cggtagtgga-------------
F6ZPD4_BCL2L10-01       ---------------------------aagcggggct-------------
A0A5F5Q151_MCL1-01      atgaagacgatgtcaaatctttgtctcgagtgatggc-------------
A0A5F5Q151_MCL1-02      atgaagacgatgtcaaatctttgtctcgagtgatggc-------------
                                                                          

A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatg--aaatt
A0A5F5PK00_BCL2A1-      tttgaacccaaa------tctggctggctgacttttctggaag--ttact
A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatg--aaatt
A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatg--aaatt
A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatg--aaatt
A0A3Q2H0F6_BCL2L1-      -------------------tgaactcttccgggatgg--ggtg---aact
A0A3Q2H0F6_BCL2L1-      -------------------tgaactcttccgggatgg--ggtg---aact
A0A5F5PML6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcgacagcagaag---agct
A0A5F5PML6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcgacagcagaag---agct
A0A5F5PML6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcgacagcagaag---agct
A0A3Q2HRY3_BCL2-01      -------------------ggagctcttcagggatgg--ggtg---aact
A0A3Q2HRY3_BCL2-02      -------------------ggagctcttcagggatgg--ggtg---aact
F6ZPD4_BCL2L10-01       -------------------acaagctggagctgaggg--agtggaaggcc
A0A5F5Q151_MCL1-01      -------------------ccacgttttcagtgacgg--agtgacaaact
A0A5F5Q151_MCL1-02      -------------------ccacgttttcagtgacgg--agtgacaaact
                                                                  *       

A0A5F5PK00_BCL2A1-      gagacagaagagatcatcagggacattttccaacaaggcaaaacctgctt
A0A5F5PK00_BCL2A1-      ggaa----------------------------------------------
A0A5F5PK00_BCL2A1-      gagacagaagagatcatcagggacattttccaacaaggcaaaacctgctt
A0A5F5PK00_BCL2A1-      gagacagaagagatcatcagggacattttccaacaaggcaaaacctgctt
A0A5F5PK00_BCL2A1-      gagacagaagagatcatcagggacattttccaacaaggcaaaacctgctt
A0A3Q2H0F6_BCL2L1-      ggggtcgca-----------------ttgtgg---------cctttttct
A0A3Q2H0F6_BCL2L1-      ggggtcgca-----------------ttgtgg---------cctttttct
A0A5F5PML6_BCL2L2-      ggaagcaca--------ctttcatggctgtggttcagtcaaccgtgttac
A0A5F5PML6_BCL2L2-      ggaagcaca--------ctttcatggctgtggttcagtcaaccgtgttac
A0A5F5PML6_BCL2L2-      ggaagcaca--------ctttcatggctgtggttcagtcaaccgtgttac
A0A3Q2HRY3_BCL2-01      gggggagga-----------------ttgtgg---------ccttctttg
A0A3Q2HRY3_BCL2-02      gggggagga-----------------ttgtgg---------ccttctttg
F6ZPD4_BCL2L10-01       ggcgt-gga-----------------ccggga-----------ctggccg
A0A5F5Q151_MCL1-01      ggggcagga-----------------ttgtga---------ctcttattt
A0A5F5Q151_MCL1-02      ggggcagga-----------------ttgtga---------ctcttattt
                        *                                                 

A0A5F5PK00_BCL2A1-      tatcccacgg------taccagttcaatagcaatcacatgg---------
A0A5F5PK00_BCL2A1-      ---------------------------------------ag---------
A0A5F5PK00_BCL2A1-      tatcccacgg------taccagttcaatagcaatcacatgg---------
A0A5F5PK00_BCL2A1-      tatcccacgg------taccagttcaatagcaatcacatgg---------
A0A5F5PK00_BCL2A1-      tatcccacgg------taccagttcaatagcaatcacatgg---------
A0A3Q2H0F6_BCL2L1-      ccttcggtgg------ggcactgtgcgtgg-------aaagcgt------
A0A3Q2H0F6_BCL2L1-      ccttcggtgg------ggcactgtgcgtgg-------aaagcgt------
A0A5F5PML6_BCL2L2-      catactctgt------gacaaatttagtggccatcccaaagggtttgcat
A0A5F5PML6_BCL2L2-      catactctgt------gacaaatttagtggccatcccaaagggtttgcat
A0A5F5PML6_BCL2L2-      catactctgt------gacaaatttagtggccatcccaaagggtttgcat
A0A3Q2HRY3_BCL2-01      agttcggtgg------ggtcatgtgtgtgg-------agagcgt------
A0A3Q2HRY3_BCL2-02      agttcggtgg------ggtcatgtgtgtgg-------agagcgt------
F6ZPD4_BCL2L10-01       cgcctggtggacttcctgt-------------------gcgcat------
A0A5F5Q151_MCL1-01      cttttggtgcctttgtggccaaacacttga-------agagtat------
A0A5F5Q151_MCL1-02      cttttggtgcctttgtggccaaacacttga-------agagtat------
                                                                *         

A0A5F5PK00_BCL2A1-      -------------atatggtgaaattagcatcacctgaggaaattttgtc
A0A5F5PK00_BCL2A1-      -------------atgt-gtgaaat--acttttcctgaagcaatactac-
A0A5F5PK00_BCL2A1-      -------------atatggtgaaattagcatcacctgaggaaattttgtc
A0A5F5PK00_BCL2A1-      -------------atatggtgaaattagcatcacctgaggaaattttgtc
A0A5F5PK00_BCL2A1-      -------------atatggtgaaattagcatcacctgaggaaattttgtc
A0A3Q2H0F6_BCL2L1-      -------------agacaaggagatgcaggtattggtgag----------
A0A3Q2H0F6_BCL2L1-      -------------agacaaggagatgcaggtattggtgag----------
A0A5F5PML6_BCL2L2-      atatagagttctcagacaaaga---------atcagtgaggacttccctg
A0A5F5PML6_BCL2L2-      atatagagttctcagacaaaga---------atcagtgaggacttccctg
A0A5F5PML6_BCL2L2-      atatagagttctcagacaaaga---------atcagtgaggacttccctg
A0A3Q2HRY3_BCL2-01      -------------caaccggga---------------ga----tgtcgcc
A0A3Q2HRY3_BCL2-02      -------------caaccggga---------------ga----tgtcgcc
F6ZPD4_BCL2L10-01       -------------ggctcaag----------------gggcggcaccgcg
A0A5F5Q151_MCL1-01      -------------aaaccaaga---------------aagctgcatcgaa
A0A5F5Q151_MCL1-02      -------------aaaccaaga---------------aagctgcatcgaa
                                            *                             

A0A5F5PK00_BCL2A1-      acttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttc
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      acttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttc
A0A5F5PK00_BCL2A1-      acttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttc
A0A5F5PK00_BCL2A1-      acttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttc
A0A3Q2H0F6_BCL2L1-      ---tcggatcgcaacct-------gg-----------------atggcca
A0A3Q2H0F6_BCL2L1-      ---tcggatcgcaacct-------gg-----------------atggcca
A0A5F5PML6_BCL2L2-      gccttagatgagtccctatttagagg-----------------aaggcaa
A0A5F5PML6_BCL2L2-      gccttagatgagtccctatttagagg-----------------aaggcaa
A0A5F5PML6_BCL2L2-      gccttagatgagtccctatttagagg-----------------aaggcaa
A0A3Q2HRY3_BCL2-01      cc--tggtggacaacatcg-------ccctgtgg---------atgactg
A0A3Q2HRY3_BCL2-02      cc--tggtggacaacatcg-------ccctgtgg---------atgactg
F6ZPD4_BCL2L10-01       cc--tggctg---------------------------------gaggctc
A0A5F5Q151_MCL1-01      ccattagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactg
A0A5F5Q151_MCL1-02      ccattagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactg
                                                                          

A0A5F5PK00_BCL2A1-      gggaggaggccttgtcaacagcag--------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gggaggaggccttgtcaacagggggacttgatctcatcctcatgccaggt
A0A5F5PK00_BCL2A1-      gggaggaggccttgtcaacagggggacttgatctcatcctcatgccaggt
A0A5F5PK00_BCL2A1-      gggaggaggccttgtcaacagggggacttgatctcatcctcatgccaggt
A0A3Q2H0F6_BCL2L1-      ctta--------cctgaatgaccacctagagccttgg-----atccaaga
A0A3Q2H0F6_BCL2L1-      ctta--------cctgaatgaccacctagagccttgg-----atccaaga
A0A5F5PML6_BCL2L2-      atcaaggtgatccctaaacga--accaacagaccaggcatcagtacaaca
A0A5F5PML6_BCL2L2-      atcaaggtgatccctaaacga--accaacagaccaggcatcagtacaaca
A0A5F5PML6_BCL2L2-      atcaaggtgatccctaaacga--accaacagaccaggcatcagtacaaca
A0A3Q2HRY3_BCL2-01      aata--------cctgaaccggcacctgcacacctggatccaggataacg
A0A3Q2HRY3_BCL2-02      aata--------cctgaaccggcacctgcacacctggatccaggataacg
F6ZPD4_BCL2L10-01       acta--------t-------------------------------------
A0A5F5Q151_MCL1-01      gcta--------gtcaaac----------------------------aaa
A0A5F5Q151_MCL1-02      gcta--------gtcaaac----------------------------aaa
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      cttgggttt----gataagcatggcaaccggttggggaggggcaagggct
A0A5F5PK00_BCL2A1-      cttgggttt----gataagcatggcaaccggttggggaggggcaagggct
A0A5F5PK00_BCL2A1-      cttgggttt----gataagcatggcaaccggttggggaggggcaagggct
A0A3Q2H0F6_BCL2L1-      gaacgg------cggctgg---gacacctttgtggaactctacgggaaca
A0A3Q2H0F6_BCL2L1-      gaacgg------cggctggaaagaaactgctttggggaccttctgctact
A0A5F5PML6_BCL2L2-      gaccggggtttcccacgagcccgataccg-tgccaggaccactaactaca
A0A5F5PML6_BCL2L2-      gaccggggtttcccacgagcccgataccg-tgccaggaccactaactaca
A0A5F5PML6_BCL2L2-      gaccggggtttcccacgagcccgataccg-tgccaggaccactaactaca
A0A3Q2HRY3_BCL2-01      ga-----------ggctgg---gacgccttt-------------------
A0A3Q2HRY3_BCL2-02      ga-----------ggctgg-----caacttt-------------------
F6ZPD4_BCL2L10-01       -------------ggctgg---gatggcttttgtgacttctc--------
A0A5F5Q151_MCL1-01      ga-----------ggctgg---gatgggtttgtggagttctt--------
A0A5F5Q151_MCL1-02      ga-----------ggctgg---gatgggtttgtggagttctt--------
                                                                          

A0A5F5PK00_BCL2A1-      ----------------------------------cctggagatga-----
A0A5F5PK00_BCL2A1-      ------------------------------------------tga-----
A0A5F5PK00_BCL2A1-      actatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccc
A0A5F5PK00_BCL2A1-      actatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccc
A0A5F5PK00_BCL2A1-      actatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccc
A0A3Q2H0F6_BCL2L1-      acgcggcagcc-----gaaagccggaagggcca----ggagc--------
A0A3Q2H0F6_BCL2L1-      tcgtttcatccctgatgagactctca--ggccaaggcggagccttacagc
A0A5F5PML6_BCL2L2-      acagttc--ccgctctcgattctacagtggttt----------taacagc
A0A5F5PML6_BCL2L2-      acagttc--ccgctctcgattctacagtggttt----------taacagc
A0A5F5PML6_BCL2L2-      acagttc--ccgctctcgattctacagtggttt----------taacagc
A0A3Q2HRY3_BCL2-01      -------------gt---ggaactgtacggc--cccagca-------tgc
A0A3Q2HRY3_BCL2-02      -------------gccaagcaccaacaggct--ctcaggaaatgttcagc
F6ZPD4_BCL2L10-01       ---------actcaca------ctgccagct--tctcagagg-atactgc
A0A5F5Q151_MCL1-01      ---------ccatgtagaggacctagaaggtggcatcagaaatgtgctgc
A0A5F5Q151_MCL1-02      ---------ccatgtagaggacctagaaggtggcatcagaaatgtgctgc
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      tacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagt
A0A5F5PK00_BCL2A1-      tacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagt
A0A5F5PK00_BCL2A1-      tacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagt
A0A3Q2H0F6_BCL2L1-      --gcttcaaccgctggttcctgacgggcatgactgtg------g------
A0A3Q2H0F6_BCL2L1-      tagctccaagctacagtgctttttgggca-gactcca------gagctcc
A0A5F5PML6_BCL2L2-      aggccccggggtcgcgt-ctacaggggccgggctaga------gcgacat
A0A5F5PML6_BCL2L2-      aggccccggggtcgcgt-ctacaggggccgggctaga------gcgacat
A0A5F5PML6_BCL2L2-      aggccccggggtcgcgt-ctacaggggccgggctaga------gcgacat
A0A3Q2HRY3_BCL2-01      ggccgctgtttgatttctcctggctgtctct-------------------
A0A3Q2HRY3_BCL2-02      ggtgggtggaccattcattctggctctccattgcagaatctttgtgtgtc
F6ZPD4_BCL2L10-01       tg-----gtccggtttcttctgtcatgcttttcagca-------------
A0A5F5Q151_MCL1-01      tg-----g--------cttttg-caggtgttgctgga-------------
A0A5F5Q151_MCL1-02      tg-----g--------cttttg-caggtgttgctgga-------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      ggacgaaaatgacatgaaggtgg---------------------------
A0A5F5PK00_BCL2A1-      ggacgaaaatgacatgaaggtgg---------------------------
A0A5F5PK00_BCL2A1-      ggacgaaaatgacatgaaggtgg---------------------------
A0A3Q2H0F6_BCL2L1-      -ctggt-----gtggttctgctg---------------------------
A0A3Q2H0F6_BCL2L1-      cctcggaactagaggtttttct----------------------------
A0A5F5PML6_BCL2L2-      catggagatcgtgcttgattctg---------------------------
A0A5F5PML6_BCL2L2-      catggagatcgtgcttgattctg---------------------------
A0A5F5PML6_BCL2L2-      catg------------gtttctg---------------------------
A0A3Q2HRY3_BCL2-01      --------gaaggcgctgctcag----------tctggccctggtg----
A0A3Q2HRY3_BCL2-02      aagggcaggaaattggttttcagagaagaaaaatatga-cttggtgttta
F6ZPD4_BCL2L10-01       --------tcagtc------tta---------------------------
A0A5F5Q151_MCL1-01      --------gtaggcgctggtttg---------------------------
A0A5F5Q151_MCL1-02      --------gtaggcgctggtttg---------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      -------------------------------------atgaagtccttta
A0A5F5PK00_BCL2A1-      -------------------------------------atgaagtccttta
A0A5F5PK00_BCL2A1-      -------------------------------------atgaagtccttta
A0A3Q2H0F6_BCL2L1-      -------------------------------------ggctcactcttca
A0A3Q2H0F6_BCL2L1-      ---------------------------------------ctcgctcttca
A0A5F5PML6_BCL2L2-      -------------------------------------gtcaataccttc-
A0A5F5PML6_BCL2L2-      -------------------------------------gtcaataccttc-
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      -------------------------gga---------gcttgcatca---
A0A3Q2HRY3_BCL2-02      acttcagacaaggatgtaatcgacaggacacccatccgcatgtatcaggg
F6ZPD4_BCL2L10-01       -------------------------------------atctacctctgga
A0A5F5Q151_MCL1-01      -------------------------------------gcatatct-----
A0A5F5Q151_MCL1-02      -------------------------------------gcatatct-----
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      tgaagactcttcagcat---------------------------------
A0A5F5PK00_BCL2A1-      tgaagactcttcagcat---------------------------------
A0A5F5PK00_BCL2A1-      tgaagactcttcagcat---------------------------------
A0A3Q2H0F6_BCL2L1-      gt--------cgga------------------------------------
A0A3Q2H0F6_BCL2L1-      ggaaatgccattgc------------------------------------
A0A5F5PML6_BCL2L2-      -ccactgactttgg------------------------------------
A0A5F5PML6_BCL2L2-      -ccactgactttgg------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      ---------------------------------------ccctgggtgcc
A0A3Q2HRY3_BCL2-02      aaggaagagtagagaggcagaaatacaaagccagtgcagacctccgtgca
F6ZPD4_BCL2L10-01       caaaattat-----------------------------------------
A0A5F5Q151_MCL1-01      ----aataa-----------------------------------------
A0A5F5Q151_MCL1-02      ----aataa-----------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      ------------------------------------------------ct
A0A5F5PK00_BCL2A1-      ------------------------------------------------ct
A0A5F5PK00_BCL2A1-      ------------------------------------------------ct
A0A3Q2H0F6_BCL2L1-      ------------------------------------------------ag
A0A3Q2H0F6_BCL2L1-      ------------------------------------------------aa
A0A5F5PML6_BCL2L2-      ------------------------------------------------aa
A0A5F5PML6_BCL2L2-      ------------------------------------------------aa
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      t-------------------atctgggccaca----------------ag
A0A3Q2HRY3_BCL2-02      tgctgctgcacctgctggaaatccaggttccagttctgtttctcagtgag
F6ZPD4_BCL2L10-01       ------------------------------------------------ca
A0A5F5Q151_MCL1-01      ------------------------------------------------ga
A0A5F5Q151_MCL1-02      ------------------------------------------------ga
                                                                          

A0A5F5PK00_BCL2A1-      ---
A0A5F5PK00_BCL2A1-      ---
A0A5F5PK00_BCL2A1-      taa
A0A5F5PK00_BCL2A1-      taa
A0A5F5PK00_BCL2A1-      taa
A0A3Q2H0F6_BCL2L1-      tga
A0A3Q2H0F6_BCL2L1-      tga
A0A5F5PML6_BCL2L2-      taa
A0A5F5PML6_BCL2L2-      taa
A0A5F5PML6_BCL2L2-      tag
A0A3Q2HRY3_BCL2-01      tga
A0A3Q2HRY3_BCL2-02      taa
F6ZPD4_BCL2L10-01       tga
A0A5F5Q151_MCL1-01      tag
A0A5F5Q151_MCL1-02      tag
                           

© 1998-2021Legal notice