Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2H0F6_BCL2L1-      atgtc----------------tcagagcaa----------ccgggagctg
A0A3Q2H0F6_BCL2L1-      atgtc----------------tcagagcaa----------ccgggagctg
A0A5F5PML6_BCL2L2-      atggcggcggcggcggcggcggcagcagca----------gcgggggct-
A0A5F5PML6_BCL2L2-      atggcgaccccagcctcagccccagacaca-----------cgggctcta
A0A5F5PML6_BCL2L2-      atggcgaccccagcctcagccccagacaca-----------cgggctcta
A0A3Q2HRY3_BCL2-01      atggcgcacgctg--------ggagaacagggtatgataaccgggagata
A0A3Q2HRY3_BCL2-02      atggcgcacgctg--------ggagaacagggtatgataaccgggagata
F6ZPD4_BCL2L10-01       -------gccgtg--------gcggaggcg----------ctgagggagc
A0A5F5Q151_MCL1-01      atgtttggcctga--------aaagaaacg----------c--agtaatc
A0A5F5Q151_MCL1-02      atgtttggcctga--------aaagaaacg----------c--agtaatc
                                                *                   *     

A0A3Q2H0F6_BCL2L1-      gtggttgactttctctc--ctacaagctttcccagaaaggatacaactg-
A0A3Q2H0F6_BCL2L1-      gtggttgactttctctc--ctacaagctttcccagaaaggatacaactg-
A0A5F5PML6_BCL2L2-      ---gcgggcggtcgggg--ctccgggccggggcggcggcgccat-cttgt
A0A5F5PML6_BCL2L2-      gtggcagactttgtagg--ctataagctgaggcagaagggttatgtttgt
A0A5F5PML6_BCL2L2-      gtggcagactttgtagg--ctataagctgaggcagaagggttatgtttgt
A0A3Q2HRY3_BCL2-01      gtgatgaagtacatcca--ctataagctgtcgcagaggggctac------
A0A3Q2HRY3_BCL2-02      gtgatgaagtacatcca--ctataagctgtcgcagaggggctac------
F6ZPD4_BCL2L10-01       gcacggcgctactgctgatcgactacctgcagcgccgcgcccgg------
A0A5F5Q151_MCL1-01      ggactcaacctctactg----------tgggggggccgggttgg------
A0A5F5Q151_MCL1-02      ggactcaacctctactg----------tgggggggccgggttgg------
                                                                          

A0A3Q2H0F6_BCL2L1-      -----------------gagtcagtttagtgacgt--ggaagagaacaga
A0A3Q2H0F6_BCL2L1-      -----------------gagtcagtttagtgacgt--ggaagagaacaga
A0A5F5PML6_BCL2L2-      gcccggggccggtggggaggccggggagggggccccggggggcgcagggg
A0A5F5PML6_BCL2L2-      ggagctggccccggggagggcccagccgctgaccc-----actgcaccaa
A0A5F5PML6_BCL2L2-      ggagctggccccggggagggcccagccgctgaccc-----actgcaccaa
A0A3Q2HRY3_BCL2-01      -------------gagtggg--atgccggagacgc-----------gggc
A0A3Q2HRY3_BCL2-02      -------------gagtggg--atgccggagacgc-----------gggc
F6ZPD4_BCL2L10-01       -------------gagccggccacgcccgaggtgg-----------ccgt
A0A5F5Q151_MCL1-01      -------------gggccggc---------ggcgg-----------cggc
A0A5F5Q151_MCL1-02      -------------gggccggc---------ggcgg-----------cggc
                                           *          *                   

A0A3Q2H0F6_BCL2L1-      actgaggccccagaagggactgaatcaga---------------------
A0A3Q2H0F6_BCL2L1-      actgaggccccagaagggactgaatcaga---------------------
A0A5F5PML6_BCL2L2-      actacgggaacggcctg----gagtctgaggaactggagcctgaggagct
A0A5F5PML6_BCL2L2-      gccatgcgggcagctggagatgagtttga-gacccgcttccggcgcacct
A0A5F5PML6_BCL2L2-      gccatgcgggcagctggagatgagtttga-gacccgcttccggcgcacct
A0A3Q2HRY3_BCL2-01      gccgcgcccctg--------------------------------------
A0A3Q2HRY3_BCL2-02      gccgcgcccctg--------------------------------------
F6ZPD4_BCL2L10-01       gctgcgctgc----------------------------------------
A0A5F5Q151_MCL1-01      gcctcgtcgccgg-------------------------------------
A0A5F5Q151_MCL1-02      gcctcgtcgccgg-------------------------------------
                         *   *                                            

A0A3Q2H0F6_BCL2L1-      -------gatggagacc---------------------------------
A0A3Q2H0F6_BCL2L1-      -------gatggagacc---------------------------------
A0A5F5PML6_BCL2L2-      gct----gctggagcccgag------------------------------
A0A5F5PML6_BCL2L2-      tctctgatctggcggctcag------------------------------
A0A5F5PML6_BCL2L2-      tctctgatctggcggctcag------------------------------
A0A3Q2HRY3_BCL2-01      -----------ggggccacc------------------------------
A0A3Q2HRY3_BCL2-02      -----------ggggccacc------------------------------
F6ZPD4_BCL2L10-01       -----------gtggccgcc------------------------------
A0A5F5Q151_MCL1-01      -------gagggcggcttttggctgcggggaaggaggccacggcccggcg
A0A5F5Q151_MCL1-02      -------gagggcggctttt------------------------------
                                   * * *                                  

A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      agagggagggggaggggaggccggcgcggtgattggcggaagcgccggcg
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      ggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccc
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      ---------------------cccagtgcca--tcaatggcaaccc----
A0A3Q2H0F6_BCL2L1-      ---------------------cccagtgcca--tcaatggcaaccc----
A0A5F5PML6_BCL2L2-      ----------ccg-----gagcccg-----agcccgaagaggagcc----
A0A5F5PML6_BCL2L2-      ----------ctgcatgtgaccccgggctcagcccagcaacgcttc----
A0A5F5PML6_BCL2L2-      ----------ctgcatgtgaccccgggctcagcccagcaacgcttc----
A0A3Q2HRY3_BCL2-01      ---------------------cccgtgccgggcatcttctcctcccagcc
A0A3Q2HRY3_BCL2-02      ---------------------cccgtgccgggcatcttctcctcccagcc
F6ZPD4_BCL2L10-01       -----------cagatacagccccgcaaccagcgtgttctttccc-----
A0A5F5Q151_MCL1-01      tcccccattggcgccgagggccccgacgtcaccgcgccctcctccaggct
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      -------------------------------------------------a
A0A3Q2H0F6_BCL2L1-      -------------------------------------------------a
A0A5F5PML6_BCL2L2-      -------------------------------------------------g
A0A5F5PML6_BCL2L2-      -------------------------------------------------a
A0A5F5PML6_BCL2L2-      -------------------------------------------------a
A0A3Q2HRY3_BCL2-01      cgggcgc------------------------------------------a
A0A3Q2HRY3_BCL2-02      cgggcgc------------------------------------------a
F6ZPD4_BCL2L10-01       ----------------------------------------------gcta
A0A5F5Q151_MCL1-01      gctgttcttcgcgcccacccgctgcgcgtcgccgcctgaggggatggaag
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      tcctggcacctggcggacagccccac------------------------
A0A3Q2H0F6_BCL2L1-      tcctggcacctggcggacagccccac------------------------
A0A5F5PML6_BCL2L2-      ccccggcccc------gcgccccccc------------------------
A0A5F5PML6_BCL2L2-      cccaggtctctgacgaactcttccaa------------------------
A0A5F5PML6_BCL2L2-      cccaggtctctgacgaactcttccaa------------------------
A0A3Q2HRY3_BCL2-01      cccccgcgcccgccaggacctccccg------------------------
A0A3Q2HRY3_BCL2-02      cccccgcgcccgccaggacctccccg------------------------
F6ZPD4_BCL2L10-01       ccgcggcttccgcggggaccacgtcg------------------------
A0A5F5Q151_MCL1-01      ccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtac
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      gagccggagcctctcgggaagcggccggctgtcctgcccttgctggagtt
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      tgtccgggaggccagcagtggcccctgcacggacggctcgctcccctcga
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      ---g----------------------------------------------
A0A3Q2H0F6_BCL2L1-      ---g----------------------------------------------
A0A5F5PML6_BCL2L2-      ---gggagctccgg--------gccctg-ggcc-----tggctcgggagc
A0A5F5PML6_BCL2L2-      ---ggtggccccaactggggccgccttgtggccttctttgtctttggagc
A0A5F5PML6_BCL2L2-      ---ggtggccccaactggggccgccttgtggccttctttgtctttggagc
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
A0A5F5Q151_MCL1-01      cgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctg
A0A5F5Q151_MCL1-02      --------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      ---------------------------gggaatggagccactg--gccac
A0A3Q2H0F6_BCL2L1-      ---------------------------gggaatggagccactg--gccac
A0A5F5PML6_BCL2L2-      --ccccggcagccaggag-------gaggaggaggagcc------gggac
A0A5F5PML6_BCL2L2-      cgcgctgtgtgctgagagtgtcaacaaggagatggagccacttgtgggac
A0A5F5PML6_BCL2L2-      cgcgctgtgtgctgagagtgtcaacaaggagatggagccacttgtgggac
A0A3Q2HRY3_BCL2-01      ------------------ctgctacccccggccgcccccgccggcgccgc
A0A3Q2HRY3_BCL2-02      ------------------ctgctacccccggccgcccccgccggcgccgc
F6ZPD4_BCL2L10-01       -----------------------------ggctggcggcacggatggcgc
A0A5F5Q151_MCL1-01      gagattatctctcgttaccttcgggaacaggctaccggcaccaaggacac
A0A5F5Q151_MCL1-02      -----------------------------ggctaccggcaccaaggacac
                                                              *      *   *

A0A3Q2H0F6_BCL2L1-      agcagcag-----------------cttggatgcccgg----------ga
A0A3Q2H0F6_BCL2L1-      agcagcag-----------------cttggatgcccgg----------ga
A0A5F5PML6_BCL2L2-      tggtcgag--------------------ggtgacccgg----------gg
A0A5F5PML6_BCL2L2-      aagtgcaggagtggatggtggcctacctggagactcggctggccgactgg
A0A5F5PML6_BCL2L2-      aagtgcaggagtggatggtggcctacctggagactcggctggccgactgg
A0A3Q2HRY3_BCL2-01      gggacctg---------------ccctcag--------------------
A0A3Q2HRY3_BCL2-02      gggacctg---------------ccctcag--------------------
F6ZPD4_BCL2L10-01       --aggcga---------------tcttcggagaccgcc----------ac
A0A5F5Q151_MCL1-01      gaagccaa---------------tgggcgg--------------------
A0A5F5Q151_MCL1-02      gaagccaa---------------tgggcgg--------------------
                                                     *                    

A0A3Q2H0F6_BCL2L1-      agtgatccccatggcagc-----------agtgaagcaagcgc---tgag
A0A3Q2H0F6_BCL2L1-      agtgatccccatggcagc-----------agtgaagcaagcgc---tgag
A0A5F5PML6_BCL2L2-      gacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcag
A0A5F5PML6_BCL2L2-      atccacagcagtggaggctgggagctggaagcgatcaaagctcgagtcag
A0A5F5PML6_BCL2L2-      atccacagcagtggaggctgggagctggaagcgatcaaagctcgagtcag
A0A3Q2HRY3_BCL2-01      -------ccctgtgccacctg--t-----ggtccacctgaccc---tgcg
A0A3Q2HRY3_BCL2-02      -------ccctgtgccacctg--t-----ggtccacctgaccc---tgcg
F6ZPD4_BCL2L10-01       gtccccagctggggccgcgtg--gc----ggcgctcgtgaccc---t---
A0A5F5Q151_MCL1-01      ------gtctggggccgccag--ccggaaggcgttagagaccc---tgcg
A0A5F5Q151_MCL1-02      ------gtctggggccgccag--ccggaaggcgttagagaccc---tgcg
                                *        *            *         * *   *   

A0A3Q2H0F6_BCL2L1-      ggaggcaggcgatgagtttg-------aactgaggtaccg-------gcg
A0A3Q2H0F6_BCL2L1-      ggaggcaggcgatgagtttg-------aactgaggtaccg-------gcg
A0A5F5PML6_BCL2L2-      ggagatggaggaagaggctgagaagctaaaagagctacag-------aac
A0A5F5PML6_BCL2L2-      ggagatggaggaagaggctgagaagctaaaagagctacag-------aac
A0A5F5PML6_BCL2L2-      ggagatggaggaagaggctgagaagctaaaagagctacag-------aac
A0A3Q2HRY3_BCL2-01      ccaggccggcgatgacttct----cccgtcgctaccgccgcgactttgcc
A0A3Q2HRY3_BCL2-02      ccaggccggcgatgacttct----cccgtcgctaccgccgcgactttgcc
F6ZPD4_BCL2L10-01       ----ggcggggacg--------------------ctgctg----------
A0A5F5Q151_MCL1-01      gcgggtcggggacgg------------------agtgcagcg-caatcac
A0A5F5Q151_MCL1-02      gcgggtcggggacgg------------------agtgcagcg-caatcac
                               *  ** *                       * *          

A0A3Q2H0F6_BCL2L1-      ggcatt---cagcgacctgacat---cccagctccacatcac-----ccc
A0A3Q2H0F6_BCL2L1-      ggcatt---cagcgacctgacat---cccagctccacatcac-----ccc
A0A5F5PML6_BCL2L2-      gaggttgagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A5F5PML6_BCL2L2-      gaggttgagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A5F5PML6_BCL2L2-      gaggttgagaagcagatgaatatgagtccacctccaggcaatgctggccc
A0A3Q2HRY3_BCL2-01      gagatgtccagccag------ctgcacctgacgcctttcacc----gcaa
A0A3Q2HRY3_BCL2-02      gagatgtccagccag------ctgcacctgacgcctttcacc----gcaa
F6ZPD4_BCL2L10-01       gagagagccccgcgg---ggaacctaccgaaagccg--------------
A0A5F5Q151_MCL1-01      gagacggccttccaa---ggcatgcttcggaaactggacatc----aaaa
A0A5F5Q151_MCL1-02      gagacggccttccaa---ggcatgcttcggaaactggacatc----aaaa
                        *           *              *     *                

A0A3Q2H0F6_BCL2L1-      agggacagcatatcagagctttgagc-aggtagtgaa-------------
A0A3Q2H0F6_BCL2L1-      agggacagcatatcagagctttgagc-aggtagtgaa-------------
A0A5F5PML6_BCL2L2-      agtgat--catgtc----cattgagg-agaagatggaggctgatgctcgt
A0A5F5PML6_BCL2L2-      agtgat--catgtc----cattgagg-agaagatggaggctgatgctcgt
A0A5F5PML6_BCL2L2-      agtgat--catgtc----cattgagg-agaagatggaggctgatgctcgt
A0A3Q2HRY3_BCL2-01      ggggacgctttgcca------------cggtagtgga-------------
A0A3Q2HRY3_BCL2-02      ggggacgctttgcca------------cggtagtgga-------------
F6ZPD4_BCL2L10-01       ---------------------------aagcggggct-------------
A0A5F5Q151_MCL1-01      atgaagacgatgtcaaatctttgtctcgagtgatggc-------------
A0A5F5Q151_MCL1-02      atgaagacgatgtcaaatctttgtctcgagtgatggc-------------
                                                          *               

A0A3Q2H0F6_BCL2L1-      -------------------tgaactcttccgggatgg--ggtg---aact
A0A3Q2H0F6_BCL2L1-      -------------------tgaactcttccgggatgg--ggtg---aact
A0A5F5PML6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcgacagcagaag---agct
A0A5F5PML6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcgacagcagaag---agct
A0A5F5PML6_BCL2L2-      tccatctatgttggcaatgtggactatggtgcgacagcagaag---agct
A0A3Q2HRY3_BCL2-01      -------------------ggagctcttcagggatgg--ggtg---aact
A0A3Q2HRY3_BCL2-02      -------------------ggagctcttcagggatgg--ggtg---aact
F6ZPD4_BCL2L10-01       -------------------acaagctggagctgaggg--agtggaaggcc
A0A5F5Q151_MCL1-01      -------------------ccacgttttcagtgacgg--agtgacaaact
A0A5F5Q151_MCL1-02      -------------------ccacgttttcagtgacgg--agtgacaaact
                                                        **  *     *     * 

A0A3Q2H0F6_BCL2L1-      ggggtcgca---------ttgtgg---------cctttttctccttcggt
A0A3Q2H0F6_BCL2L1-      ggggtcgca---------ttgtgg---------cctttttctccttcggt
A0A5F5PML6_BCL2L2-      ggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactct
A0A5F5PML6_BCL2L2-      ggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactct
A0A5F5PML6_BCL2L2-      ggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactct
A0A3Q2HRY3_BCL2-01      gggggagga---------ttgtgg---------ccttctttgagttcggt
A0A3Q2HRY3_BCL2-02      gggggagga---------ttgtgg---------ccttctttgagttcggt
F6ZPD4_BCL2L10-01       ggcgt-gga---------ccggga-----------ctggccgcgcctggt
A0A5F5Q151_MCL1-01      ggggcagga---------ttgtga---------ctcttatttcttttggt
A0A5F5Q151_MCL1-02      ggggcagga---------ttgtga---------ctcttatttcttttggt
                        **      *           * *             *            *

A0A3Q2H0F6_BCL2L1-      gg------ggcactgtgcgtgg-------aaagcgt--------------
A0A3Q2H0F6_BCL2L1-      gg------ggcactgtgcgtgg-------aaagcgt--------------
A0A5F5PML6_BCL2L2-      gt------gacaaatttagtggccatcccaaagggtttgcatatatagag
A0A5F5PML6_BCL2L2-      gt------gacaaatttagtggccatcccaaagggtttgcatatatagag
A0A5F5PML6_BCL2L2-      gt------gacaaatttagtggccatcccaaagggtttgcatatatagag
A0A3Q2HRY3_BCL2-01      gg------ggtcatgtgtgtgg-------agagcgt--------------
A0A3Q2HRY3_BCL2-02      gg------ggtcatgtgtgtgg-------agagcgt--------------
F6ZPD4_BCL2L10-01       ggacttcctgt-------------------gcgcat--------------
A0A5F5Q151_MCL1-01      gcctttgtggccaaacacttga-------agagtat--------------
A0A5F5Q151_MCL1-02      gcctttgtggccaaacacttga-------agagtat--------------
                        *                               *  *              

A0A3Q2H0F6_BCL2L1-      -----agacaaggagatgcaggtattggtgag-------------tcgga
A0A3Q2H0F6_BCL2L1-      -----agacaaggagatgcaggtattggtgag-------------tcgga
A0A5F5PML6_BCL2L2-      ttctcagacaaaga---------atcagtgaggacttccctggccttaga
A0A5F5PML6_BCL2L2-      ttctcagacaaaga---------atcagtgaggacttccctggccttaga
A0A5F5PML6_BCL2L2-      ttctcagacaaaga---------atcagtgaggacttccctggccttaga
A0A3Q2HRY3_BCL2-01      -----caaccggga---------------ga----tgtcgcccc--tggt
A0A3Q2HRY3_BCL2-02      -----caaccggga---------------ga----tgtcgcccc--tggt
F6ZPD4_BCL2L10-01       -----ggctcaag----------------gggcggcaccgcgcc--tggc
A0A5F5Q151_MCL1-01      -----aaaccaaga---------------aagctgcatcgaaccattagc
A0A5F5Q151_MCL1-02      -----aaaccaaga---------------aagctgcatcgaaccattagc
                                    *                                   * 

A0A3Q2H0F6_BCL2L1-      tcgcaacct-------gg-----------------atggccactta----
A0A3Q2H0F6_BCL2L1-      tcgcaacct-------gg-----------------atggccactta----
A0A5F5PML6_BCL2L2-      tgagtccctatttagagg-----------------aaggcaaatcaaggt
A0A5F5PML6_BCL2L2-      tgagtccctatttagagg-----------------aaggcaaatcaaggt
A0A5F5PML6_BCL2L2-      tgagtccctatttagagg-----------------aaggcaaatcaaggt
A0A3Q2HRY3_BCL2-01      ggacaacatcg-------ccctgtgg---------atgactgaata----
A0A3Q2HRY3_BCL2-02      ggacaacatcg-------ccctgtgg---------atgactgaata----
F6ZPD4_BCL2L10-01       tg---------------------------------gaggctcacta----
A0A5F5Q151_MCL1-01      agaaagcatcacagatgtcctcgtaaggacaaaacgagactggcta----
A0A5F5Q151_MCL1-02      agaaagcatcacagatgtcctcgtaaggacaaaacgagactggcta----
                                                             * *     *    

A0A3Q2H0F6_BCL2L1-      ----cctgaatgaccacctagagccttgg-----atccaagagaacgg--
A0A3Q2H0F6_BCL2L1-      ----cctgaatgaccacctagagccttgg-----atccaagagaacgg--
A0A5F5PML6_BCL2L2-      gatccctaaacga--accaacagaccaggcatcagtacaacagaccgggg
A0A5F5PML6_BCL2L2-      gatccctaaacga--accaacagaccaggcatcagtacaacagaccgggg
A0A5F5PML6_BCL2L2-      gatccctaaacga--accaacagaccaggcatcagtacaacagaccgggg
A0A3Q2HRY3_BCL2-01      ----cctgaaccggcacctgcacacctggatccaggataacgga------
A0A3Q2HRY3_BCL2-02      ----cctgaaccggcacctgcacacctggatccaggataacgga------
F6ZPD4_BCL2L10-01       ----t---------------------------------------------
A0A5F5Q151_MCL1-01      ----gtcaaac----------------------------aaaga------
A0A5F5Q151_MCL1-02      ----gtcaaac----------------------------aaaga------
                                                                          

A0A3Q2H0F6_BCL2L1-      ----cggctggaaagaaactgctttggggaccttctgctacttcgtttca
A0A3Q2H0F6_BCL2L1-      ----cggctgg---gacacctttgtggaactctacgggaacaacgcggca
A0A5F5PML6_BCL2L2-      tttcccacgagcccgataccg-tgccaggaccactaactacaacagttc-
A0A5F5PML6_BCL2L2-      tttcccacgagcccgataccg-tgccaggaccactaactacaacagttc-
A0A5F5PML6_BCL2L2-      tttcccacgagcccgataccg-tgccaggaccactaactacaacagttc-
A0A3Q2HRY3_BCL2-01      -----ggctgg---gacgccttt---------------------------
A0A3Q2HRY3_BCL2-02      -----ggctgg-----caacttt---------------------------
F6ZPD4_BCL2L10-01       -----ggctgg---gatggcttttgtgacttctc----------------
A0A5F5Q151_MCL1-01      -----ggctgg---gatgggtttgtggagttctt----------------
A0A5F5Q151_MCL1-02      -----ggctgg---gatgggtttgtggagttctt----------------
                               *  *           *                           

A0A3Q2H0F6_BCL2L1-      tccctgatgagactctca--ggccaaggcggagccttacagctagctcca
A0A3Q2H0F6_BCL2L1-      gcc-----gaaagccggaagggcca----ggagc----------gcttca
A0A5F5PML6_BCL2L2-      -ccgctctcgattctacagtggttt----------taacagcaggccccg
A0A5F5PML6_BCL2L2-      -ccgctctcgattctacagtggttt----------taacagcaggccccg
A0A5F5PML6_BCL2L2-      -ccgctctcgattctacagtggttt----------taacagcaggccccg
A0A3Q2HRY3_BCL2-01      -----gt---ggaactgtacggc--cccagca-------tgcggccgctg
A0A3Q2HRY3_BCL2-02      -----gccaagcaccaacaggct--ctcaggaaatgttcagcggtgggtg
F6ZPD4_BCL2L10-01       -actcaca------ctgccagct--tctcagagg-atactgctg-----g
A0A5F5Q151_MCL1-01      -ccatgtagaggacctagaaggtggcatcagaaatgtgctgctg-----g
A0A5F5Q151_MCL1-02      -ccatgtagaggacctagaaggtggcatcagaaatgtgctgctg-----g
                                            *                             

A0A3Q2H0F6_BCL2L1-      agctacagtgctttttgggca-gactcca------gagctcccctcggaa
A0A3Q2H0F6_BCL2L1-      accgctggttcctgacgggcatgactgtg------g-------ctggt--
A0A5F5PML6_BCL2L2-      gggtcgcgt-ctacaggggccgggctaga------gcgacatcatggaga
A0A5F5PML6_BCL2L2-      gggtcgcgt-ctacaggggccgggctaga------gcgacatcatg----
A0A5F5PML6_BCL2L2-      gggtcgcgt-ctacaggggccgggctaga------gcgacatcatggaga
A0A3Q2HRY3_BCL2-01      tttgatttctcctggctgtctct---------------------------
A0A3Q2HRY3_BCL2-02      gaccattcattctggctctccattgcagaatctttgtgtgtcaagggcag
F6ZPD4_BCL2L10-01       tccggtttcttctgtcatgcttttcagca---------------------
A0A5F5Q151_MCL1-01      --------cttttg-caggtgttgctgga---------------------
A0A5F5Q151_MCL1-02      --------cttttg-caggtgttgctgga---------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      ctagaggtttttct------------------------------------
A0A3Q2H0F6_BCL2L1-      ---gtggttctgctg-----------------------------------
A0A5F5PML6_BCL2L2-      tcgtgcttgattctg-----------------------------------
A0A5F5PML6_BCL2L2-      --------gtttctg-----------------------------------
A0A5F5PML6_BCL2L2-      tcgtgcttgattctg-----------------------------------
A0A3Q2HRY3_BCL2-01      gaaggcgctgctcag----------tctggccctggtg------------
A0A3Q2HRY3_BCL2-02      gaaattggttttcagagaagaaaaatatga-cttggtgtttaacttcaga
F6ZPD4_BCL2L10-01       tcagtc------tta-----------------------------------
A0A5F5Q151_MCL1-01      gtaggcgctggtttg-----------------------------------
A0A5F5Q151_MCL1-02      gtaggcgctggtttg-----------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      -------------------------------ctcgctcttcaggaaatgc
A0A3Q2H0F6_BCL2L1-      -----------------------------ggctcactcttcagt------
A0A5F5PML6_BCL2L2-      -----------------------------gtcaataccttc--ccactga
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      -----------------------------gtcaataccttc--ccactga
A0A3Q2HRY3_BCL2-01      -----------------gga---------gcttgcatca-----------
A0A3Q2HRY3_BCL2-02      caaggatgtaatcgacaggacacccatccgcatgtatcagggaaggaaga
F6ZPD4_BCL2L10-01       -----------------------------atctacctctggacaaaatta
A0A5F5Q151_MCL1-01      -----------------------------gcatatct---------aata
A0A5F5Q151_MCL1-02      -----------------------------gcatatct---------aata
                                                                          

A0A3Q2H0F6_BCL2L1-      cattgc--------------------------------------------
A0A3Q2H0F6_BCL2L1-      --cgga--------------------------------------------
A0A5F5PML6_BCL2L2-      ctttgg--------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      ctttgg--------------------------------------------
A0A3Q2HRY3_BCL2-01      -------------------------------ccctgggtgcct-------
A0A3Q2HRY3_BCL2-02      gtagagaggcagaaatacaaagccagtgcagacctccgtgcatgctgctg
F6ZPD4_BCL2L10-01       t-------------------------------------------------
A0A5F5Q151_MCL1-01      a-------------------------------------------------
A0A5F5Q151_MCL1-02      a-------------------------------------------------
                                                                          

A0A3Q2H0F6_BCL2L1-      ----------------------------------------aatga
A0A3Q2H0F6_BCL2L1-      ----------------------------------------agtga
A0A5F5PML6_BCL2L2-      ----------------------------------------aataa
A0A5F5PML6_BCL2L2-      ------------------------------------------tag
A0A5F5PML6_BCL2L2-      ----------------------------------------aataa
A0A3Q2HRY3_BCL2-01      ------------atctgggccaca----------------agtga
A0A3Q2HRY3_BCL2-02      cacctgctggaaatccaggttccagttctgtttctcagtgagtaa
F6ZPD4_BCL2L10-01       ----------------------------------------catga
A0A5F5Q151_MCL1-01      ----------------------------------------gatag
A0A5F5Q151_MCL1-02      ----------------------------------------gatag
                                                                  *  

© 1998-2020Legal notice