Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        atgaccga------------------------ctgtgagtttggatatat
F7CP56_BCL2A1-04        atgaccga------------------------ctgtgagtttggatatat
A0A3Q2H0F6_BCL2L1-      atgtctc--------agagcaa----------ccgggagctggtggttga
A0A3Q2H0F6_BCL2L1-      atgtctc--------agagcaa----------ccgggagctggtggttga
A0A3Q2HRY3_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
A0A3Q2HRY3_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
F6ZPD4_BCL2L10-01       -------gccgtggcggaggcg----------ctgagggagcgcacggcg
F7AVA6_MCL1-02          atgtttggcctgaaaagaaacg----------c--agtaatcggactcaa
F7AVA6_MCL1-01          atgtttggcctgaaaagaaacg----------c--agtaatcggactcaa
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        -----------tcacatgctggcccaggactacctgaagtac--------
F7CP56_BCL2A1-04        -----------tcacatgctggcccaggactacctgaagtac--------
A0A3Q2H0F6_BCL2L1-      ctttctctc--ctacaagctttcccagaaaggatacaactggagtcagtt
A0A3Q2H0F6_BCL2L1-      ctttctctc--ctacaagctttcccagaaaggatacaactggagtcagtt
A0A3Q2HRY3_BCL2-02      gtacatcca--ctataagctgtcgcagaggggctacgagtgg--------
A0A3Q2HRY3_BCL2-01      gtacatcca--ctataagctgtcgcagaggggctacgagtgg--------
F6ZPD4_BCL2L10-01       ctactgctgatcgactacctgcagcgccgcgcccgggagccg--------
F7AVA6_MCL1-02          cctctactg----------tgggggggccgggttgggggccg--------
F7AVA6_MCL1-01          cctctactg----------tgggggggccgggttgggggccg--------
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      tagtgacgtggaagagaacagaactgaggccccagaaggg----------
A0A3Q2H0F6_BCL2L1-      tagtgacgtggaagagaacagaactgaggccccagaaggg----------
A0A3Q2HRY3_BCL2-02      --g--atgccggagacgcgggcgccgcgcccctg-----ggggccacc--
A0A3Q2HRY3_BCL2-01      --g--atgccggagacgcgggcgccgcgcccctg-----ggggccacc--
F6ZPD4_BCL2L10-01       --gccacgcccgaggtggccgtgctgcgctgc-------gtggccgcc--
F7AVA6_MCL1-02          --gc---------ggcggcggcgcctcgtcgccgggagggcggctttt--
F7AVA6_MCL1-01          --gc---------ggcggcggcgcctcgtcgccgggagggcggcttttgg
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ctgcggggaaggaggccacggcccggcgagagggagggggaggggaggcc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ggcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      -------------------------------------------------a
A0A3Q2H0F6_BCL2L1-      -------------------------------------------------a
A0A3Q2HRY3_BCL2-02      -------------------------------------------------c
A0A3Q2HRY3_BCL2-01      -------------------------------------------------c
F6ZPD4_BCL2L10-01       ---------------------------------------cagatacagcc
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          gccggactccctgagggtcgcgcggccctcccccattggcgccgagggcc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ctgaatcagagatg------------------------------------
A0A3Q2H0F6_BCL2L1-      ctgaatcagagatg------------------------------------
A0A3Q2HRY3_BCL2-02      ccgtgccgggcatcttctcctcccagcccgggcgc---------------
A0A3Q2HRY3_BCL2-01      ccgtgccgggcatcttctcctcccagcccgggcgc---------------
F6ZPD4_BCL2L10-01       ccgcaaccagcgtgttctttccc---------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacccgc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ------------------------gagacccccagtgccatcaatggcaa
A0A3Q2H0F6_BCL2L1-      ------------------------gagacccccagtgccatcaatggcaa
A0A3Q2HRY3_BCL2-02      ---------------------------acccccgcgcccgccaggacctc
A0A3Q2HRY3_BCL2-01      ---------------------------acccccgcgcccgccaggacctc
F6ZPD4_BCL2L10-01       ------------------------gctaccgcggcttccgcggggaccac
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          tgcgcgtcgccgcctgaggggatggaagccccggccgccgacgccatcat
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ccca----------------------------------------------
A0A3Q2H0F6_BCL2L1-      ccca----------------------------------------------
A0A3Q2HRY3_BCL2-02      cccg----------------------------------------------
A0A3Q2HRY3_BCL2-01      cccg----------------------------------------------
F6ZPD4_BCL2L10-01       gtcg----------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          gtcgcccgaggaggagctggacgggtacgagccggagcctctcgggaagc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ccctgcacggacggctcgctcccctcgacgccgcccccagcagaggagga
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      ----------------------------------------------tcct
A0A3Q2H0F6_BCL2L1-      ----------------------------------------------tcct
A0A3Q2HRY3_BCL2-02      ----------------------------------------------ctgc
A0A3Q2HRY3_BCL2-01      ----------------------------------------------ctgc
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        ---gtcctgcagataccacaacctggatctggtccaagcaaaacatccag
F7CP56_BCL2A1-04        ---gtcctgcagataccacaacctggatctggtccaagcaaaacatccag
A0A3Q2H0F6_BCL2L1-      ggcacctggcggacagccccacggggaatggagccactggccacagcagc
A0A3Q2H0F6_BCL2L1-      ggcacctggcggacagccccacggggaatggagccactggccacagcagc
A0A3Q2HRY3_BCL2-02      tacccccggccgcccccgccggcgccgcgggacctgccctcag-------
A0A3Q2HRY3_BCL2-01      tacccccggccgcccccgccggcgccgcgggacctgccctcag-------
F6ZPD4_BCL2L10-01       -------ggctggcggcacggatggcgc--aggcgatcttcggagaccgc
F7AVA6_MCL1-02          -------ggctaccggcaccaaggacacgaagccaatgggcgg-------
F7AVA6_MCL1-01          gggaacaggctaccggcaccaaggacacgaagccaatgggcgg-------
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        agtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatt
F7CP56_BCL2A1-04        agtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatt
A0A3Q2H0F6_BCL2L1-      agcttggatgcccgggaagtgatccccatggcagc-agtgaagcaagcgc
A0A3Q2H0F6_BCL2L1-      agcttggatgcccgggaagtgatccccatggcagc-agtgaagcaagcgc
A0A3Q2HRY3_BCL2-02      ----------ccctgtg------ccacctgt-----ggtccacctgaccc
A0A3Q2HRY3_BCL2-01      ----------ccctgtg------ccacctgt-----ggtccacctgaccc
F6ZPD4_BCL2L10-01       cacgtccccagctgggg------ccgcgtggc----ggcgctcgtgaccc
F7AVA6_MCL1-02          ---------gtctgggg------ccgccagccggaaggcgttagagaccc
F7AVA6_MCL1-01          ---------gtctgggg------ccgccagccggaaggcgttagagaccc
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        tgaaaccatgcttggacaattttcatgttgtgtccatagatgctgccaga
F7CP56_BCL2A1-04        tgaaaccatgcttggacaattttcatgttgtgtccatagatgctgccaga
A0A3Q2H0F6_BCL2L1-      tgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagc
A0A3Q2H0F6_BCL2L1-      tgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagc
A0A3Q2HRY3_BCL2-02      tgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgcc
A0A3Q2HRY3_BCL2-01      tgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgcc
F6ZPD4_BCL2L10-01       t-------ggcggggacg----------------ctgctg----------
F7AVA6_MCL1-02          tgcggcgggtcggggacgg--------------agtgcagcg-caatcac
F7AVA6_MCL1-01          tgcggcgggtcggggacgg--------------agtgcagcg-caatcac
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        acaatattcaatc-------------------------------------
F7CP56_BCL2A1-04        acaatattcaatc-------------------------------------
A0A3Q2H0F6_BCL2L1-      gacctgacatcccag---ctccacatcaccccagggacagcatatcagag
A0A3Q2H0F6_BCL2L1-      gacctgacatcccag---ctccacatcaccccagggacagcatatcagag
A0A3Q2HRY3_BCL2-02      gagatgtccagccag---ctgcacctgacgcctttcaccgcaaggggacg
A0A3Q2HRY3_BCL2-01      gagatgtccagccag---ctgcacctgacgcctttcaccgcaaggggacg
F6ZPD4_BCL2L10-01       gagagagccccgcggggaacctaccgaaagccg-----------------
F7AVA6_MCL1-02          gagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaaga
F7AVA6_MCL1-01          gagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaaga
                                                                          

F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        -------------------------atggaaaagcaatttgaagatggca
F7CP56_BCL2A1-01        --------------------aagtgatggaaaagcaatttgaagatggca
F7CP56_BCL2A1-04        --------------------aagtgatggaaaagcaatttgaagatggca
A0A3Q2H0F6_BCL2L1-      ctttgagc------------aggtagtgaatgaactcttccgggatgggg
A0A3Q2H0F6_BCL2L1-      ctttgagc------------aggtagtgaatgaactcttccgggatgggg
A0A3Q2HRY3_BCL2-02      ctttgcca------------cggtagtggaggagctcttcagggatgggg
A0A3Q2HRY3_BCL2-01      ctttgcca------------cggtagtggaggagctcttcagggatgggg
F6ZPD4_BCL2L10-01       --------------------aagcggggctacaagctggagctgagggag
F7AVA6_MCL1-02          cgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggag
F7AVA6_MCL1-01          cgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggag
                                                                          

F7CP56_BCL2A1-03        --------------------atgacc------------gactgtattctc
F7CP56_BCL2A1-02        tcattaactggggaagaattatgaccatatttgcatttgaaggtattctc
F7CP56_BCL2A1-01        tcattaactggggaagaattatgaccatatttgcatttgaaggtattctc
F7CP56_BCL2A1-04        tcattaactggggaagaattatgaccatatttgcatttgaaggtattctc
A0A3Q2H0F6_BCL2L1-      tg---aactggggtcgcattgtggcctttttctccttcggtgg------g
A0A3Q2H0F6_BCL2L1-      tg---aactggggtcgcattgtggcctttttctccttcggtgg------g
A0A3Q2HRY3_BCL2-02      tg---aactgggggaggattgtggccttctttgagttcggtgg------g
A0A3Q2HRY3_BCL2-01      tg---aactgggggaggattgtggccttctttgagttcggtgg------g
F6ZPD4_BCL2L10-01       tggaaggccggcgt-ggaccggga--ctggccgcgcctggtggacttcct
F7AVA6_MCL1-02          tgacaaactggggcaggattgtgactcttatttcttttggtgcctttgtg
F7AVA6_MCL1-01          tgacaaactggggcaggattgtgactcttatttcttttggtgcctttgtg
                                              *               *           

F7CP56_BCL2A1-03        atcaagaaacttctaccagagcgaattgccccaga------tgtggatac
F7CP56_BCL2A1-02        atcaagaaacttctaccagagcgaattgccccaga------tgtggatac
F7CP56_BCL2A1-01        atcaagaaacttctaccagagcgaattgccccaga------tgtggatac
F7CP56_BCL2A1-04        atcaagaaacttctaccagagcgaattgccccaga------tgtggatac
A0A3Q2H0F6_BCL2L1-      gcactgtgcgt------ggaaagcgtagacaaggaga----tgcaggtat
A0A3Q2H0F6_BCL2L1-      gcactgtgcgt------ggaaagcgtagacaaggaga----tgcaggtat
A0A3Q2HRY3_BCL2-02      gtcatgtgtgt------ggagagcgtcaaccgggaga----tgtcgcccc
A0A3Q2HRY3_BCL2-01      gtcatgtgtgt------ggagagcgtcaaccgggaga----tgtcgcccc
F6ZPD4_BCL2L10-01       gt------------------gcgcatggctcaag-gggcggcaccgcgcc
F7AVA6_MCL1-02          gccaaacactt------gaagagtataaaccaagaaagctgcatcgaacc
F7AVA6_MCL1-01          gccaaacactt------gaagagtataaaccaagaaagctgcatcgaacc
                                              *  *       *           *    

F7CP56_BCL2A1-03        --ttacaaggagatttcttacttt-----------------gttgctgag
F7CP56_BCL2A1-02        --ttacaaggagatttcttacttt-----------------gttgctgag
F7CP56_BCL2A1-01        --ttacaaggagatttcttacttt-----------------gttgctgag
F7CP56_BCL2A1-04        --ttacaaggagatttcttacttt-----------------gttgctgag
A0A3Q2H0F6_BCL2L1-      --tggtgagtcggatcgcaa----cctgg------------atggccact
A0A3Q2H0F6_BCL2L1-      --tggtgagtcggatcgcaa----cctgg------------atggccact
A0A3Q2HRY3_BCL2-02      --tggtggacaacatcg-------ccctgtgg---------atgactgaa
A0A3Q2HRY3_BCL2-01      --tggtggacaacatcg-------ccctgtgg---------atgactgaa
F6ZPD4_BCL2L10-01       --tggctg---------------------------------gaggctcac
F7AVA6_MCL1-02          attagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggc
F7AVA6_MCL1-01          attagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggc
                          *                                          *    

F7CP56_BCL2A1-03        ttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggt
F7CP56_BCL2A1-02        ttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggt
F7CP56_BCL2A1-01        ttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggt
F7CP56_BCL2A1-04        ttcataacgaaaaacacaggagaatggataaggcaaaatggaggctggga
A0A3Q2H0F6_BCL2L1-      tacctgaatgaccacctagagccttggatccaagagaacggcggctggaa
A0A3Q2H0F6_BCL2L1-      tacctgaatgaccacctagagccttggatccaagagaacggcggctgg--
A0A3Q2HRY3_BCL2-02      tacctgaaccggcacctgcacacctggatccaggataacggaggctgg--
A0A3Q2HRY3_BCL2-01      tacctgaaccggcacctgcacacctggatccaggataacggaggctgg--
F6ZPD4_BCL2L10-01       tat---------------------------------------ggctgg--
F7AVA6_MCL1-02          tagtcaaac----------------------------aaagaggctgg--
F7AVA6_MCL1-01          tagtcaaac----------------------------aaagaggctgg--
                        *                                         ******  

F7CP56_BCL2A1-03        gattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctga
F7CP56_BCL2A1-02        gattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctga
F7CP56_BCL2A1-01        gattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctga
F7CP56_BCL2A1-04        aaatggctttgtaaagaagtttgaacccaaa------tctggctggctga
A0A3Q2H0F6_BCL2L1-      agaaact----------------------------gctttggggaccttc
A0A3Q2H0F6_BCL2L1-      -gacacc----------------------------tttgtggaactctac
A0A3Q2HRY3_BCL2-02      ---caac----------------------------ttt------------
A0A3Q2HRY3_BCL2-01      -gacgcc----------------------------ttt------------
F6ZPD4_BCL2L10-01       -gatggc----------------------------ttttgtgacttctc-
F7AVA6_MCL1-02          -gatggg----------------------------tttgtggagttctt-
F7AVA6_MCL1-01          -gatggg----------------------------tttgtggagttctt-
                                                             *            

F7CP56_BCL2A1-03        gcatgcaagatgaaattgagacagaagagatcatcagggacattttccaa
F7CP56_BCL2A1-02        gcatgcaagatgaaattgagacagaagagatcatcagggacattttccaa
F7CP56_BCL2A1-01        gcatgcaagatgaaattgagacagaagagatcatcagggacattttccaa
F7CP56_BCL2A1-04        cttttctggaagttactggaa-----------------------------
A0A3Q2H0F6_BCL2L1-      tgctacttcgtttcatccctgatgagac------------------tctc
A0A3Q2H0F6_BCL2L1-      gggaacaacgcggcagcc-----gaaag------------------ccgg
A0A3Q2HRY3_BCL2-02      --------------------gccaagca------------------ccaa
A0A3Q2HRY3_BCL2-01      --------------------gt---gga------------------actg
F6ZPD4_BCL2L10-01       ----------------actcaca------------------------ctg
F7AVA6_MCL1-02          ----------------ccatgtagagga------------------ccta
F7AVA6_MCL1-01          ----------------ccatgtagagga------------------ccta
                                                                          

F7CP56_BCL2A1-03        caaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacat
F7CP56_BCL2A1-02        caaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacat
F7CP56_BCL2A1-01        caaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacat
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      a--ggccaaggcggagccttacagctagctccaagctacagtgctttttg
A0A3Q2H0F6_BCL2L1-      aagggcca----ggagc----------gcttcaaccgctggttcctgacg
A0A3Q2HRY3_BCL2-02      caggct--ctcaggaaatgttcagcggtgggtggaccattcattctggct
A0A3Q2HRY3_BCL2-01      tacggc--cccagca-------tgcggccgctgtttgatttctcctggct
F6ZPD4_BCL2L10-01       ccagct--tctcagagg-atactgctg-----gtccggtttcttctgtca
F7AVA6_MCL1-02          gaaggtggcatcagaaatgtgctgctg-----g--------cttttg-ca
F7AVA6_MCL1-01          gaaggtggcatcagaaatgtgctgctg-----g--------cttttg-ca
                                                                          

F7CP56_BCL2A1-03        ggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
F7CP56_BCL2A1-02        ggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
F7CP56_BCL2A1-01        ggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
F7CP56_BCL2A1-04        agatgt-gtgaaat--acttttcctgaagcaatactac------------
A0A3Q2H0F6_BCL2L1-      ggca-gactccagagctcccctcggaa------ctagaggtttttct---
A0A3Q2H0F6_BCL2L1-      ggcatgactgtgg-------ctggt-----------gtggttctgctg--
A0A3Q2HRY3_BCL2-02      ctccattgcagaatctttgtgtgtcaagggcaggaaattggttttcagag
A0A3Q2HRY3_BCL2-01      gtctct---------------------------gaaggcgctgctcag--
F6ZPD4_BCL2L10-01       tgcttttcagca---------------------tcagtc------tta--
F7AVA6_MCL1-02          ggtgttgctgga---------------------gtaggcgctggtttg--
F7AVA6_MCL1-01          ggtgttgctgga---------------------gtaggcgctggtttg--
                                                                          

F7CP56_BCL2A1-03        catcctggaatattc-----------------------------------
F7CP56_BCL2A1-02        catcctggaatattc-----------------------------------
F7CP56_BCL2A1-01        catcctggaatattc-----------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      aagaaaaatatga-cttggtgtttaacttcagacaaggatgtaatcgaca
A0A3Q2HRY3_BCL2-01      --------tctggccctggtg-----------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
                                                                          

F7CP56_BCL2A1-03        ------------atcagcctggtgaggaggaggttcgggaggaggccttg
F7CP56_BCL2A1-02        ------------atcagcctggtgaggaggaggttcgggaggaggccttg
F7CP56_BCL2A1-01        ------------atcagcctggtgaggaggaggttcgggaggaggccttg
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------ctcgctcttcaggaaatgccattgc-----------
A0A3Q2H0F6_BCL2L1-      ------------ggctcactcttcagt--------cgga-----------
A0A3Q2HRY3_BCL2-02      ggacacccatccgcatgtatcagggaaggaagagtagagaggcagaaata
A0A3Q2HRY3_BCL2-01      gga---------gcttgcatca----------------------------
F6ZPD4_BCL2L10-01       ------------atctacctctggacaaaattat----------------
F7AVA6_MCL1-02          ------------gcatatct---------aataa----------------
F7AVA6_MCL1-01          ------------gcatatct---------aataa----------------
                                                                          

F7CP56_BCL2A1-03        tcaacagggggacttgatctcatcctcatgccaggtcttgggtttgataa
F7CP56_BCL2A1-02        tcaacagggggacttgatctcatcctcatgccaggtcttgggtttgataa
F7CP56_BCL2A1-01        tcaacagcag----------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      caaagccagt----------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
                                                                          

F7CP56_BCL2A1-03        gcatggcaaccggttggggaggggcaagggctactatgacacctacctga
F7CP56_BCL2A1-02        gcatggcaaccggttggggaggggcaagggctactatgacacctacctga
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      ---------gcagacctccgtgcatgctgctgcacctgctggaaatccag
A0A3Q2HRY3_BCL2-01      -------------ccctgggtgcct-------------------atctgg
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
                                                                          

F7CP56_BCL2A1-03        agcgctgtctgcagcaccaggaagtgaagccctacaccctggccttggct
F7CP56_BCL2A1-02        agcgctgtctgcagcaccaggaagtgaagccctacaccctggccttggct
F7CP56_BCL2A1-01        ----------------cctggagatga-----------------------
F7CP56_BCL2A1-04        ------------------------tga-----------------------
A0A3Q2H0F6_BCL2L1-      ----------------------aatga-----------------------
A0A3Q2H0F6_BCL2L1-      ----------------------agtga-----------------------
A0A3Q2HRY3_BCL2-02      gttccagttctgtttctcagtgagtaa-----------------------
A0A3Q2HRY3_BCL2-01      gccaca----------------agtga-----------------------
F6ZPD4_BCL2L10-01       ----------------------catga-----------------------
F7AVA6_MCL1-02          ----------------------gatag-----------------------
F7AVA6_MCL1-01          ----------------------gatag-----------------------
                                                *                         

F7CP56_BCL2A1-03        ttcaaagaacaaatttgtgtccaggtcccagtggacgaaaatgacatgaa
F7CP56_BCL2A1-02        ttcaaagaacaaatttgtgtccaggtcccagtggacgaaaatgacatgaa
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
                                                                          

F7CP56_BCL2A1-03        ggtggatgaagtcctttatgaagactcttcagcatcttaa
F7CP56_BCL2A1-02        ggtggatgaagtcctttatgaagactcttcagcatcttaa
F7CP56_BCL2A1-01        ----------------------------------------
F7CP56_BCL2A1-04        ----------------------------------------
A0A3Q2H0F6_BCL2L1-      ----------------------------------------
A0A3Q2H0F6_BCL2L1-      ----------------------------------------
A0A3Q2HRY3_BCL2-02      ----------------------------------------
A0A3Q2HRY3_BCL2-01      ----------------------------------------
F6ZPD4_BCL2L10-01       ----------------------------------------
F7AVA6_MCL1-02          ----------------------------------------
F7AVA6_MCL1-01          ----------------------------------------
                                                                

© 1998-2020Legal notice