Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=738 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctggaaagaaactgctttggggaccttctgctacttcgtttcatccctgatgagactctcaggccaaggcggagccttac
agctagctccaagctacagtgctttttgggcagactccagagctcccctcggaactagaggtttttctctcgctcttcag
gaaatgccattgcaatga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A3Q2HRY3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=858 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctggcaactttgccaagcaccaacaggctctcaggaaatgttcagcggtgggtggaccattcattctggctctccattgc
agaatctttgtgtgtcaagggcaggaaattggttttcagagaagaaaaatatgacttggtgtttaacttcagacaaggat
gtaatcgacaggacacccatccgcatgtatcagggaaggaagagtagagaggcagaaatacaaagccagtgcagacctcc
gtgcatgctgctgcacctgctggaaatccaggttccagttctgtttctcagtgagtaa
>gnl|bcl2dbcds|A0A3Q2HRY3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|F6ZPD4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Equus caballus GN=BCL2L10 (length=561 residues).
gccgtggcggaggcgctgagggagcgcacggcgctactgctgatcgactacctgcagcgccgcgcccgggagccggccac
gcccgaggtggccgtgctgcgctgcgtggccgcccagatacagccccgcaaccagcgtgttctttcccgctaccgcggct
tccgcggggaccacgtcgggctggcggcacggatggcgcaggcgatcttcggagaccgccacgtccccagctggggccgc
gtggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcggggaacctaccgaaagccgaagcggggcta
caagctggagctgagggagtggaaggccggcgtggaccgggactggccgcgcctggtggacttcctgtgcgcatggctca
aggggcggcaccgcgcctggctggaggctcactatggctgggatggcttttgtgacttctcactcacactgccagcttct
cagaggatactgctggtccggtttcttctgtcatgcttttcagcatcagtcttaatctacctctggacaaaattatcatg
a
>gnl|bcl2dbcds|F7AVA6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=594 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagcc
ggaaggcgttagagaccctgcggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggcgctggtttggcatatctaataagatag
>gnl|bcl2dbcds|F7AVA6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7CP56_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=696 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcaa
tagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatc
agcctggtgaggaggaggttcgggaggaggccttgtcaacagcagcctggagatga
>gnl|bcl2dbcds|F7CP56_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=636 residues).
atgaccgactgtattctcatcaagaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttctta
ctttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagt
atcaaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttc
caacaaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctga
ggaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaa
cagggggacttgatctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctac
tatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaat
ttgtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|F7CP56_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactactga
>gnl|bcl2dbcds|F7CP56_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=693 residues).
atggaaaagcaatttgaagatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaa
gaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacga
aaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttcc
atctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttat
cccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
catcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctc
atgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctg
tctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacg
aaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
© 1998-2020Legal notice