Dataset for CDS BCL-2-like of organism Athene cunicularia

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A663N622_BCL2A1-      atgga-------aactgctgag-------------------ttctattac
A0A663M6G8_MCL1-01      ------------aggggcaggg----------------------------
A0A663MPN9_BCL2-01      atgcaagaatataacggcagtgattttacttggttgacaaatccccttgc
                                    *   ** * *                            

A0A663N622_BCL2A1-      gtttattacttagctcaagatta---------------------------
A0A663M6G8_MCL1-01      --------ctggtgccag--------------------------------
A0A663MPN9_BCL2-01      ctaccttcctgccatcagaagcagccccacagctcaccgcacttttccaa
                                **     **                                 

A0A663N622_BCL2A1-      ----------------------------------------tctgcaatat
A0A663M6G8_MCL1-01      ----------------------------------------gctgcaaact
A0A663MPN9_BCL2-01      gtctctcccacagacacgatgcgctccagcatttatcctcgctgcgagct
                                                                 **** *  *

A0A663N622_BCL2A1-      g--------tgcttcaggagtcacatcttggaccagctcaaaccagggtt
A0A663M6G8_MCL1-01      g---------acttctgtgctgtggttctgatgcggtggggcttt--aaa
A0A663MPN9_BCL2-01      gcccgcaggccctgccgggctgcagccccgcggccgcgcagaatc--gtc
                        *          ** * *   *        *   * *              

A0A663N622_BCL2A1-      gctcacgtcttgcgaaa------cattgcatcttcgc-------------
A0A663M6G8_MCL1-01      gcccttg---tgagaaaggggagtgtgatgtcatctc-------------
A0A663MPN9_BCL2-01      caccttgccctgcgccaggcgggcgacgagttctcccgccgctaccagag
                           *  *   ** *  *             *  ** *             

A0A663N622_BCL2A1-      ------tgcaagatcaaaccgaggaggct----ctcagaccattcttgga
A0A663M6G8_MCL1-01      -----ttgcagga--atgcttcggaagctggaaat----------ccaga
A0A663MPN9_BCL2-01      ggactttgcccaa--atgtccggccagctgcacctgacgcccttcacggc
                              ***   *  *      *   ***     *             * 

A0A663N622_BCL2A1-      caggattgatattacctctgtagctgttgccaagagaattttcaatggtg
A0A663M6G8_MCL1-01      aagaggaag------atctgcagtcagtgtgtgaagtggctgcccacgtg
A0A663MPN9_BCL2-01      caggggccg------cttcgtgg-cggtg-gtggaggagc--------tc
                         **             *  *  *    **     **            * 

A0A663N622_BCL2A1-      tcatgcaagaaaaatttgctgatggaaatactaactggggacgaattatg
A0A663M6G8_MCL1-01      ttcag--------------tgatggagtaacaaactggggtagagtggtg
A0A663MPN9_BCL2-01      ttccg--------------agacggggt---taactggggcaggattgtg
                        *   *               ** **       ********  *  *  **

A0A663N622_BCL2A1-      accatatttacgtttggaggtcttctcactaagaagcttcaagagcat--
A0A663M6G8_MCL1-01      acgctcatctcatttggtgcctttgttgc-gaaacacctgaagagcataa
A0A663MPN9_BCL2-01      gccttcttcgagtttggcggc------gt-gatgtgtgtggagagcgtca
                         *  *  *    ***** *            *      *  ***** *  

A0A663N622_BCL2A1-      ----ggag------ttcagctcactggaga-----------ggag----a
A0A663M6G8_MCL1-01      accaggagaaatgcatcagctcgttggcag-----------ggatcatca
A0A663MPN9_BCL2-01      accgggag--atgtctccccttgtagacagcatcgccgcctggatgaccg
                            ****       **  **    *               ***      

A0A663N622_BCL2A1-      aggagcagatttcttatttcatcacagagtacataataaacaacaaagcc
A0A663M6G8_MCL1-01      cgga--tgcact--catctcatcgaagcg--------------------c
A0A663MPN9_BCL2-01      agtacctgaaccggcacct-------gca--------------------c
                         * *   *       *  *       *                      *

A0A663N622_BCL2A1-      gaatggatagatgcaaacggtggctgggaaaatggcttcctaacgaagtt
A0A663M6G8_MCL1-01      gagtggctcatgagccaaggaggctggg---agggctttgttgacttctt
A0A663MPN9_BCL2-01      aactggatccaggacaacggaggctggg---atgccttcgtcgagttgta
                         * *** *        * ** *******   * * ***  *       * 

A0A663N622_BCL2A1-      tgaaa------gaagatcactactatctttctccaaaattacagccatct
A0A663M6G8_MCL1-01      tcg----agtcgaggacc--tggaaggcagcatcagaaatgtactgatgg
A0A663MPN9_BCL2-01      tggcaacagtgtgaggcctttgtttgatttctcctggatctctctgaaga
                        *             *  *  *         *  *   *        *   

A0A663N622_BCL2A1-      tcatagctgttttctccttattcagaga----------------------
A0A663M6G8_MCL1-01      catttgcaggtgtggctggactgggagc--------------aagcttag
A0A663MPN9_BCL2-01      ctatcctgagtctggttctggtgggagcttgcatcactcttggcgcttat
                           *      * *        *  ***                       

A0A663N622_BCL2A1-      -----gtacta----ctga
A0A663M6G8_MCL1-01      cct--acatgatccggtga
A0A663MPN9_BCL2-01      ctcggacataa----gtag
                               *  *     *  

© 1998-2020Legal notice