Dataset for CDS BCL-2-like of organism Athene cunicularia

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A663M6G8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Athene cunicularia GN=MCL-1 (length=474 residues).
aggggcagggctggtgccaggctgcaaactgacttctgtgctgtggttctgatgcggtggggctttaaagcccttgtgag
aaaggggagtgtgatgtcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgcagtcagtgt
gtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcatttggtgccttt
gttgcgaaacacctgaagagcataaaccaggagaaatgcatcagctcgttggcagggatcatcacggatgcactcatctc
atcgaagcgcgagtggctcatgagccaaggaggctgggagggctttgttgacttctttcgagtcgaggacctggaaggca
gcatcagaaatgtactgatggcatttgcaggtgtggctggactgggagcaagcttagcctacatgatccggtga
>gnl|bcl2dbcds|A0A663MPN9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Athene cunicularia GN=BCL-2 (length=639 residues).
atgcaagaatataacggcagtgattttacttggttgacaaatccccttgcctaccttcctgccatcagaagcagccccac
agctcaccgcacttttccaagtctctcccacagacacgatgcgctccagcatttatcctcgctgcgagctgcccgcaggc
cctgccgggctgcagccccgcggccgcgcagaatcgtccaccttgccctgcgccaggcgggcgacgagttctcccgccgc
taccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtggcggtggt
ggaggagctcttccgagacggggttaactggggcaggattgtggccttcttcgagtttggcggcgtgatgtgtgtggaga
gcgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaac
tggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtgtgaggcctttgtttgatttctcctg
gatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A663N622_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Athene cunicularia GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaagattatctgcaatatgtgcttcaggagtcacatcttgg
accagctcaaaccagggttgctcacgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacgtttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcaaacggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctccaaaattaca
gccatcttcatagctgttttctccttattcagagagtactactga
© 1998-2020Legal notice